MENDELIAN GENETICS Genetics The Study of Heredity Passing

MENDELIAN GENETICS Genetics – The Study of Heredity – Passing traits from parents to offspring How are genes inherited?

Chromosomes contain chromosome #15 Genes produce Proteins determine ATGC sequence folded amino acid sequence Traits blue eyes But what are the rules that allow us to predict the likelihood of inheriting certain traits over others?

In the mid-1800 s, Gregor Mendel was the first to figure it out! � � Mendel was raised on a small farm in Austria. He was always curious about nature. Mendel was trained in mathematics and biology and spent most of his life as a monk. 1822 -1884 � Mendel was encouraged to explore his curiosity scientifically. � Mendel chose GARDEN PEA PLANTS as his test organism. � Mendel’s findings went unrecognized until the early 1900 s, decades after his death.

Mendel’s Findings The Laws of Heredity were discovered using PEA PLANTS, but they are the same laws for ALL living things!!! Law of Unit Characters Law of Dominance Law of Segregation Law of Independent Assortment

Why Peas? � Easy to care for � Characteristics are easy to identify. � Short life span, so you can get several generations in a short amount of time. � Large number of offspring at one time, providing lots of data. � Easily control the mating of pea plants in a green house. � Pea offspring can be mated with their parents and with one another.

Pea Flower Structure flower contains male and female reproductive organs pea = offspring (seed)

Mendel’s Experiments P 1 Generation (original parents) F 1 Generation F 2 Generation ted a m ( X X h) t i w Purebred tall plants were crossed with purebred short All F 1 offspring are tall. Short trait disappeared! Short trait reappears in a consistent ratio of 3 tall : 1 short P 1, F 1, and F 2 would be similar to your grandparents, your parents, and you.

Mendel’s Results THOUSANDS of offspring!!! Studied 7 different traits!!! All F 2 offspring 3: 1 ratio!!! (3 dom : 1 rec)

Important Vocabulary Allele = A gene, but in a specific form. Each characteristic (trait) is always determined by two alleles. Dominant Allele = A gene that, if present, always produces a protein (and therefore a trait). Recessive Allele = A gene that produces a protein (and therefore a trait) ONLY if present with another recessive allele.

Important Vocabulary Genotype = symbols (capital and lower case letters) that represent genes on homologous chromosomes. BB, Bb and bb are all genotypes. Phenotype = the organism’s characteristic as a result of its genes. Brown eyes and blue eyes are both phenotypes. Homozygous = a genotype showing two of the same allele. BB is homozygous dominant; bb is recessive. Heterozygous = a genotype showing two different alleles. Bb is heterozygous.

What do Mendel’s Law really mean?

Law of Unit Characters – Characteristics of an individual are controlled by hereditary factors (genes) that occur in pairs (on homologous chromosomes) � Example: Height can either be TT, Tt, or tt

Law of Dominance – the dominant allele is expressed and the recessive allele can be hidden. � This is why offspring don’t look like a complete blend of each of the parents.

Law of segregation Law of Segregation – a pair of genes are separated during the formation of gametes. You can inherit either allele with equal probability. Ex. T or t but not both. � The dominant allele is not passed on more often than the recessive allele.

Law of Independent Assortment – inheritance of most traits does not depend on other traits. � � The fact that you have brown hair has no effect on the color of eyes that you have. There are exceptions to this law, and these will be discussed later.

Punnett Squares See overhead notes.

Considering just one pair of homologous chromosomes: A A is a symbol to represent a sequence of nitrogen bases (gene) that will make a protein to produce the dominant trait. a parent genotype is heterozygous DNA replication a is a symbol to represent a sequence of nitrogen bases (gene) that will make a protein to produce the recessive trait ONLY if present with another one (aa). a A A a meiosis I A possible eggs or sperm!!! A a a meiosis II A A a a

possible eggs/sperm from parents when both are Aa A a possible gene combinations in offspring A a Summary: 1. The gamete used for each fertilization is randomly chosen. 2. The probability of inheriting either A or a from one parent is 50/50 each time an offspring is born. 3. This Punnett square predicts a 3: 1 ratio in the offspring, but this is not guaranteed, unless. . . you are looking at a LARGE NUMBER of offspring!!!

What is the difference between a gene and a trait? A gene is a sequence of nitrogen bases on a chromosome that codes for a protein. ATGCTTTCCCAGAGCTGCGT A trait is a physical feature, due to the presence of specific proteins. green eyes

• What do the letters Bb represent? B b Bb is a genotype that represents genes on homologous chromosomes • Give an example of an allele. B is a dominant allele. b is a recessive allele.

What is the difference between a genotype and a genotypic ratio? Tt Two genes that an organism has for any given trait. 1 : 2 : 1 A way to express the chances that the offspring will have a certain genotype. 25% chance the offspring will be TT. 50% chance they will be Tt. 25% chance they will be tt.

Explain what is meant by P 1, F 1, and F 2. P 1: The original parents, always a purebred (homozygous) dominant crossed with a purebred recessive. EE x ee F 1: the offspring from the above cross (first generation). all Ee (heterozygous) F 2: the second generation of offspring, achieved by mating two F 1 offspring with each other. Ee x Ee will produce the F 2 offspring

In mice, brown color is dominant over white. Two brown mice are mated several times. They have a total of 20 offspring, 14 brown, and 6 white. Determine the genotypes of the parents and all the offspring. B= brown b = white Bb Bb brown (x) brown 14 brown and 6 white B? bb Genotypes of parents: Bb (x) Bb Genotypes of offspring: B- bb

In humans, tongue-rolling is controlled by a dominant allele. A non-tongue roller man (whose parents are both tongue rollers) marries a woman who can roll her tongue. The woman’s father was a tongue roller but her mother was not. The couple have one child who is a non-tongue roller. Determine the genotypes of all the people in the problem (7 total). T= tongue roller tt t = non tongue roller TTt Tt non tongue roller (x) tongue roller t t Tt Genotypes : tt man= _____ Tt Tt His dad ______ His mom _____ Tt woman = _____ Ttt Her dad ______ Her mom _____ tt Child = ____

Skipping a Generation When a trait disappears (not seen in parents) and then reappears in offspring generation Proof that trait is controlled by a recessive gene. � Ex. Two white sheep produce a black sheep. Determine the genotypes of the parents and offspring. B= white b= black Parents: Bb (x) Bb Offspring: bb

Incomplete Dominance When there is no dominant allele for a trait and blending occurs in the heterozygous condition

Example: Flower in Four- O’Clocks and Snapdragons Red (RR), Pink (RW), White (WW) Pink Flower (x) Pink Flower RW (x) RW R Phenotypic Ratio: Genotypic Ratio: W R RR RW WW 1 : 2 : 1 Red : Pink : White 1 RR : : 2 RW : : 1 WW Phenotypic & Genotypic Ratios are the same!

Pedigree Chart Show relationships in a family (family tree) Shaded individuals have different phenotype from unshaded Circles – females Squares- males

bb B- Bb bb bb B = Brown eyes Bb b = blue eyes Bb Bb Bb bb Bb Bb WRONG! B - bb Bbb bb B-

DIHYBRID CROSSES – a cross involving two traits Demonstrates Law of Independent Assortment

Tt. Rr – Tall and Round outside first ( T x t ) ( R x r) inside last F O I L First, Outside, Inside, Last

Key 1 T= Tall t = Short R = Round r = Wrinkled Key 2 T-R- = Tall, Round T-rr = Tall, Wrinkled tt. R- = Short, Round ttrr = Short, wrinkled P 1 Pure Tall, Pure Round (x) Pure Short, Pure Wrinkled P 1 TTRR (x) ttrr Possible Gametes: TR, TR, TR (x) tr, tr, tr

Possible Gametes: TR (x) tr tr TR Tt. Rr F 1 Phenotypic Ratio: 1 : 0 : 0 Tall, Round : Tall, Wrinkled : Short, Round : Short, Wrinkled 1 st dominant trait : 1 st recessive trait : 1 st recessive trait 2 nd dominant trait : 2 nd recessive trait : 2 nd dominant trait : 2 nd recessive trait We will not be doing genotypic ratios for dihybird problems.

Find the F 2 phenotype ratio: F 1 (x) F 1 Heterozygous Tall, Heterozygous Round (x) Heterozygous Round Possible Gametes: Tt. Rr (x) Tt. Rr TR, Tr, t. R, tr (x) TR, Tr, t. R, tr

Possible Gametes: TR TR, Tr, t. R, tr (x) TR, Tr, t. R, tr Tr t. R tr TR TTRr Tt. RR Tt. Rr Tr TTRr TTrr Tt. Rr Ttrr t. R Tt. Rr tt. RR tt. Rr tr Tt. Rr Ttrr tt. Rr ttrr Phenotypic Ratio: Tall, Round : Tall, Wrinkled : Short, Round : Short, Wrinkled

Possible Gametes: TR TR, Tr, t. R, tr (x) TR, Tr, t. R, tr Tr t. R tr TR TTRr Tt. RR Tt. Rr Tr TTRr TTrr Tt. Rr Ttrr t. R Tt. Rr tt. RR tt. Rr tr Tt. Rr Ttrr tt. Rr ttrr 9 : 3 : 1 Phenotypic Ratio: Tall, Round : Tall, Wrinkled : Short, Round : Short, Wrinkled 1 st dominant trait : 1 st recessive trait : 1 st recessive trait 2 nd dominant trait : 2 nd recessive trait : 2 nd dominant trait : 2 nd recessive trait

A A B a A a B bb B A we have two possible starting line-ups in metaphase I of meiosis! b B a a A b b 4 possible GAMETES! !! b b a A b gametes with genes AB A chromosomes) a A B B A NOW, if we consider another set of genes (on different ab a A a b b BB a B A b b A a a B B a B gametes with genes Ab a. B

possible eggs/sperm from parents when both are Aa. Bb A a a b AABBAABb. Aa. BBAa. Bb b AABb. AAbb. Aa. Bb Aabb B Aa. BBAa. Bbaa. BB aa. Bb b Aa. Bb. Aabb aa. Bb aabb A a A B B A a b B

possible eggs/sperm from parents when both are Aa. Bb A a a b AABBAABb. Aa. BBAa. Bb b AABb. AAbb. Aa. Bb Aabb B Aa. BBAa. Bbaa. BB aa. Bb b Aa. Bb. Aabb aa. Bb aabb A a A B B A a b B

Another dihybrid example: The genotype must always have 4 letters! In bunnies, black hair is dominant to white hair, and long hair is dominant to short Key 1 Key 2 ü B = Black B_H_ = Black, long hair B_hh = Black, short hair ü b = White bb. H_ = white, long hair ü H = Long Hair bbhh = white, short hair ü h = Short Hair

P 1: A homozygous black, homozygous long haired bunny is crossed with a white, short haired one. P 1 BBHH (x) bbhh Determine all possibilities for gene combinations in gametes (FOIL), cross off any duplicates, and make a Punnett Square. bh P 1 BBHH (x) bbhh BH, BH, BH (x) bh, bh, bh Expected Phenotypic Ratio: (use Key 2 order) 1: 0: 0: 0 BH Bb. Hh Key 2 Black, Long Black, short white, Long white, short

A heterozygous black, heterozygous long haired bunny is crossed with a white, short haired one. Bb. Hh (x) bbhh Determine all possibilities for gene combinations in gametes (FOIL), cross off any duplicates, and make a Punnett Square. Bb. Hh (x) bbhh BH, Bh, b. H, bh (x) bh, bh, bh BH bh Bb. Hh Bh Bbhh Expected Phenotypic Ratio: (use Key 2 order) b. H bb. Hh 1: 1: 1: 1 bh bbhh

TRIHYBRID CROSSES – a cross involving three traits 1) 2) 3) 4) Genotype TTRRYY TTRr. Yy Tt. Rr. Yy 1) 2) 3) 4) Possible Gamete Combinations TRY, Tr. Y TRY, TRy, Tr. Y, Try, t. RY, t. Ry, tr. Y, try

How many Punnett squares are needed if you cross: 1 x 2 = 2 Punnett Squares 1 and 2? 2 and 3? 2 x 4 = 8 Punnett Squares 4 x 8 = 32 Punnett Squares 3 and 4?

Show what the Punnett square would look like if you crossed the following: TTRr. YY (x) TTRRYy TRY TRy TRY TTRRYy Tr. Y TTRr. Yy