Manipulating DNA Scientists can use their knowledge of

Manipulating DNA

Scientists can use their knowledge of the structure of DNA and its chemical properties to study and change DNA molecules.

Genetic Engineering - The process of producing altered DNA by making changes in the DNA code of a living organism

Genetic Engineering 1. Extract the DNA 2. Isolate a Gene 3. Separate DNA 4. Make Recombinant DNA 5. Insert Recombinant DNA 6. Cell Transformation

Genetic Engineering Isolate a Gene – isolate the pieces of DNA that contain a desired gene by cutting it with proteins known as Restriction Enzymes 2.

Desired DNA Sequence: GTTAAC GTACTACGTTAACTGTACTATCGTTA ACGTAAGCTACGTTAACCTA GTACTACGTT/AACTGTACTATCGTT/ AACGTAAGCTACGTT/AACCTA

Genetic Engineering 3. Separate DNA ▫ Gel Electrophoresis – separation of DNA using an electric voltage

Genetic Engineering 4. Make Recombinant DNA – DNA fragments are incorporated into part of the recipient cell’s DNA ▫ The new DNA that is made is known as Recombinant DNA because DNA from two sources have been recombined to produce it

Genetic Engineering 5. Insert Recombinant DNA – insert recombinant DNA into organism ▫ Insert it into bacteria ▫ Clone the bacteria containing the recombinant DNA

Genetic Engineering Cell Transformation – cells take in DNA from outside the cell, and this external DNA becomes a component of the cell’s DNA 6.