lob STR A Short Tandem Repeat Profiler for

lob. STR: A Short Tandem Repeat Profiler for Personal Genomes CSE 291 02/16/17

Intro. lob. STR Catalog Conclusion We know quite a lot about genetic variation… 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion STRs – domains of interest ATGTCAGCAGCAGCTGA 1. Medical genetics - more than 40 documented diseases OPMD Synpolydactyly Ataxia (10 types) 2. Forensics – 12 million STR profiles Fragile X Huntington Holoprosencephaly Pseudoachondroplasia 3. Genetic genealogy – a vantage point to recent events. HFG syndrome Myotonic dystrophy Cleidocranial Dysplasia ALS-FTD Despite multitude of applications, STRs are not routinely profiled in whole genome sequencing 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion Challenges in profiling STRs from short reads 1. Only reads entirely spanning an STR are informative Non informative read: TGACGCATGATGTCAACAA [CAA]4 [CAA]5 : : [CAA]? ? Ambiguity Informative read: ATGTCAACAACAACTGA 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion Challenges in profiling STRs from short reads 2. Non-reference alleles present as large indels Reference: ATGTCAACAACAATTGA Genome of interest: ATGTCAACAACAACAACAACAATTGA 15 bp indel 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion Challenges in profiling STRs from short reads 3. PCR “stutter noise” complicates calling Capillary electrophoresis Sequence reads ATGTCAACAACAACAACAACAATTGA ATGTCAACAACAATTGA ATGTCAACAACAACAACAA***TTGA ATGTCAACAA******TTGA 02/16/17 Profiling STR variation in humans Melissa Gymrek

lob. STR algorithm

Intro. lob. STR Catalog Conclusion lob. STR: an end-to-end solution for STR-profiling • Takes FASTA/FASTQ/BAM and outputs VCF • Reports read alignments and STR alleles • Supports multi-threading 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion Sensing Aim: Find informative reads and characterize STR 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion Entropy score successfully detects STRs Sj: sequence j Σ: symbol alphabet (dinucleotides) fi: frequency of symbol i 99. 4% 98. 3% AGCATATATATATG i AG A GC C CA G AT T TA TG … fi 0. 04 0. 46 0. 04 0. 08 0. 43 0. 42 0. 39 0. 04 … E = 1. 54 E(S) = 1. 8 02/16/17 Profiling STR variation in humans CAGCTATTCGGGACTGAGCGGTAT i CA A AG C GC G TA T TT TC … fi 0. 21 0. 04 0. 21 0. 08 0. 33 0. 08 0. 25 0. 08 0. 04 … E = 1. 97 E(S) = 3. 71 Melissa Gymrek

Intro. lob. STR Catalog Conclusion Entropy score partitions reads (TG)n TTTTGTGTGAAACCATGCTCGAGTGTGTGTATGTGTGTGTGTGGTGTCTTAAGACTGAAATATCTAAG TTGG Left flank STR region Right flank 2/22/12 02/16/17 Profiling STRlob. STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion Alignment Aim: Map STRs to the genome 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion Avoid gapped alignment by aligning non-repetitive regions Divide and conquer approach: TTTTGTGTGAAACCATGCTCGAGTGTGTGTATGTGTGTGTGTGGTGTCTTAAGACTGAAATATCTAAGATTAACTTGG • Build an index of all genomic STRs • Align only the flanking regions to the reference genome • Use paired end information to add specificity 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion Allelotyping Aim: determine the STR alleles 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion Removing PCR stutter noise Most stutter events are +/-1 from true allele Probability of stutter Stutter probability primarily depends on STR period Period (bp) Train parameters on hemizygous loci (male sex chroms) 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion Determine the most likely allelotype R = (13, 13, 14, 14, 15) Grid search to find maximum likelihood allelotype 17, 17 Return confidence score: 16, 16 16, 17 L(ML allelotype) 15, 15 15, 16 16, 17 Σ L(allelotype) 14, 14 14, 15 14, 16 13, 13 13, 14 13, 15 13, 16 13, 17 12, 12 12, 13 12, 14 12, 15 12, 16 12, 17 11, 12 11, 13 11, 14 11, 15 11, 16 11, 17 Allele 2 11, 11 L(reads|allelotype; model) Allele 1 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion lob. STR outperforms mainstream short read aligners at STR loci 02/16/17 Profiling STR variation in humans Melissa Gymrek

Intro. lob. STR Catalog Conclusion And now… Hip. STR! 02/16/17 Profiling STR variation in humans Melissa Gymrek