LET THERE BE LIGHT Quorum Sensing in Bacteria

LET THERE BE LIGHT: Quorum Sensing in Bacteria • Mary Shane • Alexandra Fairfield • Nick Galt • Davida Smyth • Vedham Karpakakunjaram • Carolyn Wetzel • Sarah Prescott • Monica Guha. Majumdar 1 of 10

Why did we choose Quorum Sensing? • Wanted a fun, interactive and visual way to teach a complicated system • Covers topics in the NGSS as well as Intro Biology to Microbiology, Genetics and more (we can dream!) • No known Cell Collective simulations or interactive modules for teaching quorum sensing 2 of 10

What concepts they will learn from this • Two-component signal transduction systems • Quorum sensing as a density-dependent phenomenon • Interaction between an inducer and a receptor • External factors affect quorum sensing (genetic regulation) • Positive feedback loop • Deleterious mutations and compensation in communities 3 of 10

Lesson Plan in Brief Before Class During Class After Class Watch videos, do readings Reconstruct models In class scenarios and simulations Case studies Analysis of mutations Watch videos, do readings and reflect 4 of 10

The Lux. R-Lux. I Model Quorum Sensing – Answer Key glucose density CRP Pheromone Lux. R Lux. I Lux. R-Lux. R Lux. CDABE Luciferase Bioluminescence 5 of 10

Sample Case Study After a long night of working in the lab, Student D was exhausted. Instead of putting the Vibrio culture in the 25°C incubator, they put the culture in the fridge Run Simulation Answer questions a) Impact of temperature on bacterial growth b) Impact of temperature on luminescence 6 of 10

7 of 10

Wild-type Lux. R gene >NC_006841 Lux. R ATGAACATTAAAAATATAAATGCTAATGAGAAGATAAT TGATAAAATTAAAACTTGTAATAAAGAT Students will have to translate & align the sequences >YP_206883. 1 Lux. R family transcriptional regulator MNIKNINANEKIIDKIKTCNNNKD Mutant Lux. R gene >Lux. R mutant DNA sequence ATGAACATTAAAAATACAAATGCTAATGAGAAGATAAT TGATAAAATTAAAACTTGTAATAAAGAT >Lux. R mutant protein sequence MNIKNTNANEKIIDKIKTCNNNKD => It’s a missense mutation! 8 of 10

What could we assess? • Their model reconstruction • Their graphs derived from the simulation/data • If they can identify the mutations • Their reflections on the exercise Most importantly! Can they problem solve? 9 of 10

Future Directions • Complete this Project • Test in the Classroom in the next Academic Year • Share and collaborate • Improve (if needed) • Present the results in Virginia , NSTA and other places… 10 of 10