Lecture 4 Probe primer design Objective of probe
Lecture 4: Probe & primer design
Objective of probe design: Select a complementary oligonucleotide sequence that is completely specific to a region of the target sequences which has at least one mismatch to the same region in all other (nontarget) sequences. 5’ GUCUAGGGGAUCCCUG 3’ r. RNA 3’ CAGAUCCCCUAGGGAC 5’ Probe targets the r. RNA Fluorescent label
Fundamentals for probe design Define the target group Design a probe Remember: probe sequence is reverse complement of target Examine mismatch type & location – require strong and central mismatches to destabilize non-specific binding Search probe sequence against public sequence databases Check accessibility of the probe Check hybridization temperature Tm > 56°C is ideal
Define a target group Group should be wellsupported by bootstrap values
Design a probe >> Probe | Design probes Choose your PT -Server Change Min group hits (%) to 100 Leave other parameters as default
Evaluate probe design results Lots of probe varieties! Which one to pick? ?
About mismatches An ideal probe sequence will have one or more mismatches to non-target sequences – this ensures that your probe will not hybridize to non-target sequences. UACGGUCAAUCGCUUGCG UACGGUCAACCGCUUGCG
Evaluate mismatches
Mismatches for an ideal probe Strong mismatches Non-canonical base pairs (A: A, C: C, G: G, U: U, A: C, C: U) are strongly repulsive (appear in CAPS) Canonical base pairs (g: a, g: t) are considered ‘weak’ mismatches (appear lowercase) Mismatches located in center of the sequence destabilize probe more than terminal mismatches
Search probe sequence against public databases Find species not listed in your database which would hybridize to your probe Conduct a BLAST search with your target string. http: //blast. ncbi. nlm. nih. gov/ Ribosomal Data. Base Project’s Probe Match website: http: //rdp. cme. msu. edu/probematch/search. jsp - Useful because it categories the phylogenetic grouping of species which hybridize to your probe sequence Probe Check website: http: //131. 130. 66. 200/cgi-bin/probecheck. pl - Checks your probe against the SILVA or Greengenes databases
Check accessibility of the probe • Regions of the SSU r. RNa have different accessibilities for probe hybridization • More accessible regions = brighter probe • Check Fuchs et al. 2000 AEM, 64: 4973 -82 But see also Yilmaz et al. 2006 AEM, 72: 733 -744
Check melting temperature (Tm) Melting temperature should be above 56°C Greater chance of success with hybridization Tm can be increased by increasing the length of the probe 4 GC + 2 AT calculation gives you theoretical melting temperature (listed in Probe_Design window)
Primer design Primers are short single-stranded oligonucleotides which anneal to template DNA and serve as a “primer” for DNA synthesis EXAMPLE: 5’CTGTCCACACAATCTGCCCTTTCGAAAGATCCCAAGCGAAAAGAGAGACCACAT >>>>>>>>>>> GGTCCTTCTGAGTTTGTAACAGCTGCTGGATTACACATGGCATGGATGA 3’ <<<<<<<<<<< Forward primer: 5’- CTGTCCACACAATCTGCC -3’ Reverse primer: 5’- TCATCCATGTGTT -3’ (reverse complement of target)
Objectives for primer design Select two primers, one flanking each end of the target DNA. The primers must have a sequence that is complementary to the target DNA. Choose primer sequences that are completely specific to the target DNA. Evaluate number of mismatches, as in probe design Mismatches are ideal when on the ends of sequences The primers must have similar melting temperatures. Primers should be 18 -24 basepairs long.
More about Tm For the primers to anneal to the target DNA, the annealing temperature must be below the Tm of the primers. Annealing reactions are typically carried out about 5º below the T m. If the annealing temperature is too low the primer will mis-anneal to sequences which aren’t perfectly complementary. If the annealing temperature is too high, the primer will not anneal to the target DNA. Two primers designed for a PCR experiment should have very similar Tm’s. The Tm should be within 5º of each other, but the closer the Tm’s the better
Primer design in ARB Select (NOT mark) your species of interest Problem: only allows one species to be marke Choose Probes | Design Primers
L & R positions: specifies start positions & ranges for searching (position field in alignment window) Primer distance: min/max range between primers Temperature: melting temperature based on 4 GC + 2 AT
Tutorial 6 objectives: Understand the steps necessary to design probes and primers Design a probe Determine if your probe has mismatches, and where the mismatches are located Determine if your probe is specific to your target sequence by searching public databases Design a set of sequencing primers
- Slides: 18