Lecture 11 Evolution and Development Animal development Phylogenetics

Lecture 11 • Evolution and Development • Animal development • Phylogenetics: terms and analysis

Evolution: explanation for the diversity of life/form. Development: generation of form. Evo Devo is the synthesis of these.

General animal life cycle Somatic germ-line division Germ-line fertilization

Animal development Development Sperm Zygote Egg Gametes

Origins of multicellularity Willmer Invertebrate relationships

Implicit phylogenys human chimp rat time rat worm Primordial ooze worm

Metazoan origins Three techniques used A) examine living organisms B) examine the fossil record C) examine DNA sequence

Metazoan origins Considerations when looking at the living A Divergence vs convergence

Metazoan origins Considerations when looking at the living A Divergence vs convergence Human and Squid camera eyes

Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny

Metazoan origins Polyphylogeny vs monophylogeny Polyphylogeny independent evolution of a characteristic Monophylogeny common ancestry

Evolution of a chitin exoskeleton Polyphylogeny Insects Crustacea Spiders Monophylogeny Insects Crustacea Spiders Proto-platyhelminthes No exoskeleton Common ancestor with an exoskeleton

Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny C time blurs all origins

Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny C time D data set in the present

First metazoans Willmer Invertebrate relationships

Pseudoceolomates Willmer Invertebrate relationships

Worms Willmer Invertebrate relationships

Mollusks Willmer Invertebrate relationships

Arthropods Willmer Invertebrate relationships

Deuterostomes Willmer Invertebrate relationships

Organization of the major animal groups Raff The shape of life

Organization of the major animal groups Raff The shape of life

Organization of the major animal groups Sponge Multicellular Multiple cell types No organized tissues Raff The shape of life

Organization of the major animal groups Diploblast Organized tissues Diploblastic ectoderm/endoderm Neuron-no CNS Sensory cells-no PNS Raff The shape of life

Organization of the major animal groups Acoelomate Triploblastic: ecto meso endoderms Single gut opening Bilaterally symmetric, A/P axis Organized CNS and PNS No body cavity Raff The shape of life

Organization of the major animal groups Pseudocoelomates One side of the body cavity lined with mesoderm Raff The shape of life

Organization of the major animal groups Eucoelomates Both sides of the body cavity lined with mesoderm Hydrostatic skeleton Circulatory system Raff The shape of life

Proposal for animal phylogeny Willmer Invertebrate relationships

Fossils When do we see the first fossil animals?

Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya Porifera First fossils found 700 Mya

Fossil sponges 640 -650 My old

Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya Porifera First fossils found 700 Mya

Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya Burrow trace fossils Surface trace fossils Porifera First fossils found 700 Mya

Trace and body fossils Carroll et al. , From DNA to diversity

Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya Burgess Chengjiang Doushantuo Avalon Lantian Porifera First fossils found 700 Mya

Lantian and Avalon Biota

Ediacarans: soft body preservation Raff The shape of life

Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya 700 Mya Burgess Chengjiang Doushantuo Avalon Lantian Porifera First fossils found Fossilized embryos Over 550 million years old

Doushantuo

Doushantuo Bacteria and not embryos?

Cryogenian Ediacaran Cambrian 500 Mya Marinoan Sturtian Snowball 600 Mya Burgess Chengjiang Doushantuo Avalon Lantian Porifera First fossils found 700 Mya

Chengjiang

Burgess shales

Burgess shales Soft body preservation Regular preservation

Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya Porifera First fossils found Porifera Biomarker 700 Mya

Biomarkers

Biomarkers

DNA sequence analysis Organism Organism 1 2 3 4 5 ATGTCCGTGAGTCGTCGTAGCTGAT ATGTCAGTGAGACGTCGTAGCTGAT ATGTCAGTGAGTCCTCATAGCTGAT AAGGCCGTGAGACCTCATAGCTGAT

r. RNA 18 S analysis Raff The shape of life

Choanoflagellates Cambell Biology

Choanoflagellates GENOME SEQUENCE RECENTLY COMPLETED Cambell Biology

Traditional phylogeny based on the coelum

Traditional phylogeny based on the coelum Simple to complex

DNA analysis tells a different story

Pseudocoelomy is polyphylogenic Priapulids Nematodes coelomates Rotifers

Animal phylogeny based on mitochondrial proteins reconstructed using the CAT+GTR+ Г model under a Bayesian analysis H Philippe et al. Nature 470, 255 -258 (2011) doi: 10. 1038/nature 09676

DNA analysis tells a different story Complex to simple

Odontogriphus reburrus: early lophotrochozoan Morris and Caron Science 315, 1255

Reconstruction of Diania cactiformis in dorsolateral view. Jointed armored velvet worm Transitional form. 520 Mya JN Liu et al. Nature 470, 526 -530 (2011) doi: 10. 1038/nature 09704

Base groups Complex to simple

Problem with sponges: complex to simple?

Molecular clock analysis 0 Mullusca Chordata 300 Cambrian 600 900 1200 Vendian Protostome/ Deuterostome split

Molecular clock Biomarker analysis 0 Mullusca Chordata 300 Cambrian 600 900 1200 Vendian Protostome/ Deuterostome split

A complex organism existed at the protostome deuterostome split Carroll et al. , From DNA to diversity

Is the study of living organisms the study of the radiation of Urbilateria? Carroll et al. , From DNA to diversity