Lecture 11 Evolution and Development Animal development Phylogenetics


































































- Slides: 66
Lecture 11 • Evolution and Development • Animal development • Phylogenetics: terms and analysis
Evolution: explanation for the diversity of life/form. Development: generation of form. Evo Devo is the synthesis of these.
General animal life cycle Somatic germ-line division Germ-line fertilization
Animal development Development Sperm Zygote Egg Gametes
Origins of multicellularity Willmer Invertebrate relationships
Implicit phylogenys human chimp rat time rat worm Primordial ooze worm
Metazoan origins Three techniques used A) examine living organisms B) examine the fossil record C) examine DNA sequence
Metazoan origins Considerations when looking at the living A Divergence vs convergence
Metazoan origins Considerations when looking at the living A Divergence vs convergence Human and Squid camera eyes
Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny
Metazoan origins Polyphylogeny vs monophylogeny Polyphylogeny independent evolution of a characteristic Monophylogeny common ancestry
Evolution of a chitin exoskeleton Polyphylogeny Insects Crustacea Spiders Monophylogeny Insects Crustacea Spiders Proto-platyhelminthes No exoskeleton Common ancestor with an exoskeleton
Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny C time blurs all origins
Metazoan origins Considerations when looking at the living A Divergence vs convergence B Polyphylogeny vs monophylogeny C time D data set in the present
First metazoans Willmer Invertebrate relationships
Pseudoceolomates Willmer Invertebrate relationships
Worms Willmer Invertebrate relationships
Mollusks Willmer Invertebrate relationships
Arthropods Willmer Invertebrate relationships
Deuterostomes Willmer Invertebrate relationships
Organization of the major animal groups Raff The shape of life
Organization of the major animal groups Raff The shape of life
Organization of the major animal groups Sponge Multicellular Multiple cell types No organized tissues Raff The shape of life
Organization of the major animal groups Diploblast Organized tissues Diploblastic ectoderm/endoderm Neuron-no CNS Sensory cells-no PNS Raff The shape of life
Organization of the major animal groups Acoelomate Triploblastic: ecto meso endoderms Single gut opening Bilaterally symmetric, A/P axis Organized CNS and PNS No body cavity Raff The shape of life
Organization of the major animal groups Pseudocoelomates One side of the body cavity lined with mesoderm Raff The shape of life
Organization of the major animal groups Eucoelomates Both sides of the body cavity lined with mesoderm Hydrostatic skeleton Circulatory system Raff The shape of life
Proposal for animal phylogeny Willmer Invertebrate relationships
Fossils When do we see the first fossil animals?
Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya Porifera First fossils found 700 Mya
Fossil sponges 640 -650 My old
Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya Porifera First fossils found 700 Mya
Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya Burrow trace fossils Surface trace fossils Porifera First fossils found 700 Mya
Trace and body fossils Carroll et al. , From DNA to diversity
Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya Burgess Chengjiang Doushantuo Avalon Lantian Porifera First fossils found 700 Mya
Lantian and Avalon Biota
Ediacarans: soft body preservation Raff The shape of life
Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya 700 Mya Burgess Chengjiang Doushantuo Avalon Lantian Porifera First fossils found Fossilized embryos Over 550 million years old
Doushantuo
Doushantuo Bacteria and not embryos?
Cryogenian Ediacaran Cambrian 500 Mya Marinoan Sturtian Snowball 600 Mya Burgess Chengjiang Doushantuo Avalon Lantian Porifera First fossils found 700 Mya
Chengjiang
Burgess shales
Burgess shales Soft body preservation Regular preservation
Cambrian Cryogenian Ediacaran 500 Mya Marinoan Sturtian Snowball 600 Mya Porifera First fossils found Porifera Biomarker 700 Mya
Biomarkers
Biomarkers
DNA sequence analysis Organism Organism 1 2 3 4 5 ATGTCCGTGAGTCGTCGTAGCTGAT ATGTCAGTGAGACGTCGTAGCTGAT ATGTCAGTGAGTCCTCATAGCTGAT AAGGCCGTGAGACCTCATAGCTGAT
r. RNA 18 S analysis Raff The shape of life
Choanoflagellates Cambell Biology
Choanoflagellates GENOME SEQUENCE RECENTLY COMPLETED Cambell Biology
Traditional phylogeny based on the coelum
Traditional phylogeny based on the coelum Simple to complex
DNA analysis tells a different story
Pseudocoelomy is polyphylogenic Priapulids Nematodes coelomates Rotifers
Animal phylogeny based on mitochondrial proteins reconstructed using the CAT+GTR+ Г model under a Bayesian analysis H Philippe et al. Nature 470, 255 -258 (2011) doi: 10. 1038/nature 09676
DNA analysis tells a different story Complex to simple
Odontogriphus reburrus: early lophotrochozoan Morris and Caron Science 315, 1255
Reconstruction of Diania cactiformis in dorsolateral view. Jointed armored velvet worm Transitional form. 520 Mya JN Liu et al. Nature 470, 526 -530 (2011) doi: 10. 1038/nature 09704
Base groups Complex to simple
Problem with sponges: complex to simple?
Molecular clock analysis 0 Mullusca Chordata 300 Cambrian 600 900 1200 Vendian Protostome/ Deuterostome split
Molecular clock Biomarker analysis 0 Mullusca Chordata 300 Cambrian 600 900 1200 Vendian Protostome/ Deuterostome split
A complex organism existed at the protostome deuterostome split Carroll et al. , From DNA to diversity
Is the study of living organisms the study of the radiation of Urbilateria? Carroll et al. , From DNA to diversity