Lai et al Supplement 1 A DAPI Merge

  • Slides: 2
Download presentation
Lai et al. , Supplement 1 A DAPI Merge 3 µM PC-3 0 µM

Lai et al. , Supplement 1 A DAPI Merge 3 µM PC-3 0 µM HCT 116 0 µM HUVEC 0 µM Brd. U B Supplement 1. Plumbagin inhibits the proliferation of endothelial cells and tumor cells. A. HUVEC, HCT 116 and PC 3 cells were labeled with Brd. U after 0 or 3μM plumbagin treatment for 24 h. B. Quantitative data of percent of Brd. U immunoreactive cells at indicated concentrations.

Lai et al. , Supplement 2 ** *** NC P 65 GY Plumb. (µM)

Lai et al. , Supplement 2 ** *** NC P 65 GY Plumb. (µM) + - + - - 1 1 5 5 10 10 - - - - + 1 + - 3 3 + 1 1 + 1 3 - + + - + 1 5 5 5 3 1 1 3 + 5 3 + - + 10 10 1 1 + - + 10 10 3 3 Supplement 2. P 65 overexpression in HUVEC. The p. LVX-IRES-Zs. Green 1 vector was used to overexpression p 65 within lentivirals in HUVECs. P 65 was amplified by PCR from p 65 plasmid using the following primers: 5’ CGCTCGAG ATGGACGAACTGTTCC CCCTC-3’ (sense), 5’GCTCTAGATTAAGCGTAATCTGGAACATCGTATGGGTACATGGAGCTGATCTGACTCA G -3’ (antisense). After transfecting the p 65 -Zsgreen vector and control vector into the 293 T cells, the virus-containing medium was harvested. HUVECs were infected with the virus for 24 hours and then were cultured in normal ECM medium for 24 hours and were re-infected for another 24 hours. Then, the infected HUVECs were seeded into the 98 well-plates at the density of 5, 000 cells/well. When adhered to the plates, cells were pre-treated with 0, 1 or 3μM of plumbagin for 1 hour followed by X-ray radiation at the dose of 0, 1, 5 or 10 Gy. 72 hours later, the cell viability was measured by MTS assay. Results: 1. Without plumbagin treatment, compared with NC group, p 65 overexpression in HUVEC increased the viability under X-ray treatment and substantiate the role of P 65 in radioresistance. 2. With the treatments of increasing doses of X-ray, 1μM plumbagin could reduce the proliferation induction by P 65 overexpression in HUVEC. Especially under the combined treatment of 1μM plumbagin and 1 Gy X-ray, when P 65 was overexpressed, the cell viability is significantly inhibited compared with that in P 65 -non-overexpressed cells. 3. Under the treatment of 3μM plumbagin, the cell viability was remarkably decreased no matter whether P 65 is overexpressed or not and regardless of the dose of x-ray. It was suggested that the effect of 3μM plumbagin in HUVEC viability might overshadow the effects of other factors that might influent cell viability in this experiment.