LAB 8 MOLECULAR CELL BIOLOGY Polymerase Chain Reaction

LAB (8) MOLECULAR CELL BIOLOGY Polymerase Chain Reaction

What is PCR? -PCR is a technique that takes specific sequence of DNA of small amount and amplifies it to be used for further testing. • In vitro technique -Amplify= making numerous copies of a segment of DNA - DNA Replication vs. PCR: PCR is a laboratory version of DNA Replication in cells( in vivo) -PCR was invented in the 1984 by Kary Mullis as a way to make numerous copies of DNA fragments in the laboratory. - The method depends on repeated thermal cycling. Application of PCR: 1 - Diagnosis and detection of genetic and infectious diseases. . 2 - Widely used in criminal investigations and parental test. 3 - determine evolutionary development of organisms. PCR Thermocycler

Basic requirements for PCR reaction • 1) DNA sequence of target region must be known. 2) Primers - typically 20 -30 bases in size. These can be readily produced by commercial companies. Can also be prepared using a DNA synthesizer. 3) Heat-stable DNA polymerase - e. g. Taq polymerase (an enzyme originally isolated from the bacterium Thermus aquaticus, which live in hot water and can tolerate high temperatures. 4) DNA thermal cycler - machine which can be programmed to carry out heating and cooling of samples over a number of cycles.

The three main steps of PCR • The basis of PCR is temperature changes and the effect that these temperature changes have on the DNA. • In a PCR reaction, the following series of steps is repeated 20 -40 times (note: 25 cycles usually takes about 2 hours and amplifies the DNA fragment of interest 100, 000 fold) Step 1: Denature DNA At 95 C, the DNA is denatured (i. e. the two strands are separated) Step 2: Primers Anneal At 40 C- 65 C, the primers anneal (or bind to) their complementary sequences on the single strands of DNA Step 3: DNA polymerase Extends the DNA chain At 72 C, DNA Polymerase extends the DNA chain by adding nucleotides to the 3’ ends of the primers.

Denaturation of DNA Hydrogen bonds that holds the double strand break and double-stranded DNA separate to single stranded DNA, all enzymatic reactions stop. This occurs at 95 ºC

Step 2 Annealing or Primers Binding Primers bind to the complimentary sequence on the target DNA. Primers are chosen such that one is complimentary to the one strand at one end of the target sequence and that the other is complimentary to the other strand at the other end of the target sequence. (at 40˚C- 60 ˚C )

Step 3 Extension or Primer Extension extension DNA polymerase catalyzes the extension of the strand in the 5 -3 direction, starting at the primers, attaching the appropriate nucleotide (A -T, C-G) (at 70˚C - 75˚C )

Animations • http: //www. dnalc. org/ddnalc/resources/pcr. html

Question Calculate the annealing stage in PCR technique : primer 1 : 5' GATGAGTTCGTGTCCGTACAACT 3' primer 2 : 5' GGTTATCGAAATCAGCCACAGCGCC 3' Rules : Time temperature for primer 1 = 2(A+T) + 4(G+C) Time temperature for primer 2 = 2(A+T) + 4(G+C) Primer 1+primer 2 / 2 = _____ - 5 c = ______ Time temperature for primer 1 = 2(5+7) + 4(6+5) = 68 Time temperature for primer 2 = 2(7+4) + 4(6+7)= 74 68+74 / 2 = ___71__ - 5 c = __66 C____ Calculate the number of DNA that during in (15 ) cycles by using PCR technique : Rule: 2 Number of cycle 215 = 32768 copies