Introduction to Python BCHB 524 Lecture 5 BCHB
Introduction to Python BCHB 524 Lecture 5 BCHB 524 - Edwards
Outline l l l Homework #2 Solutions Homework #1 Notes DNA as a string l l Extracting codons in DNA Counting in-frame codons in DNA Reverse Complement Program Input/Output l l raw_input, command-line arguments standard-input, standard-output, redirection BCHB 524 - Edwards 2
Homework #1 Notes l Python programs: l l Upload. py files Don't paste into comment box Don't paste into your writeup Writeup: l l l Upload. txt files, Don't paste into comment box Text document preferred BCHB 524 - Edwards 3
Homework #1 Notes l Multiple submissions: l l OK, but… …I'll ignore all except the last one Make each (re-)submission complete Grading: l l l Random grading order Comments Grading "curve" BCHB 524 - Edwards 4
Review l l Printing and execution Variables and basic data-types: l l Functions, using/calling and defining: l l l integers, floats, strings Arithmetic with, conversion between String characters and chunks, string methods Use in any expression Parameters as input, return for output Control Flow: l l if statements – conditional execution for statements – iterative execution BCHB 524 - Edwards 5
DNA as a string seq = "gcatgacgttattacgactctgtgtggcgtctgctgggg" seqlen = len(seq) # set i to 0, 3, 6, 9, . . . , 36 for i in range(0, seqlen, 3): # extract the codon as a string codon = seq[i: i+3] print codon print "Number of Met. amino-acids", seq. count("atg") BCHB 524 - Edwards 6
DNA as a string l What about upper and lower case? l l Differences between DNA and RNA sequence? l l Substitute U for each T? How about ambiguous nucleotide symbols? l l ATG vs atg? What should we do with ‘N’ and other ambiguity codes (R, Y, W, S, M, K, H, B, V, D)? Strings don’t know any biology! BCHB 524 - Edwards 7
DNA as a string seq = "gcatgacgttattacgactctgtgtggcgtctgctgggg" def in. Frame. Met(seq): seqlen = len(seq) count = 0 for i in range(0, seqlen, 3): codon = seq[i: i+3] if codon. upper() == "ATG": count = count + 1 return count print "Number of Met. amino-acids", in. Frame. Met(seq) BCHB 524 - Edwards 8
DNA as a string input_seq = "catgacgttattacgactctgtgtggcgtctgctgggg" def complement(nuc): nucleotides = 'ACGT' complements = 'TGCA' i = nucleotides. find(nuc) comp = complements[i] return comp def reverse. Complement(seq): newseq = "" for nuc in seq: newseq = complement(nuc) + newseq return newseq print "Reverse complement: ", reverse. Complement(input_seq) BCHB 524 - Edwards 9
DNA as a string input_seq = "catgacgttattacgactctgtgtggcgtctgctgggg" def complement(nuc): nucleotides = 'ACGT' complements = 'TGCA' i = nucleotides. find(nuc) if i >= 0: comp = complements[i] else: comp = nuc return comp def reverse. Complement(seq): seq = seq. upper() newseq = "" for nuc in seq: newseq = complement(nuc) + newseq return newseq print "Reverse complement: ", BCHB 524 reverse. Complement(input_seq) - Edwards 10
Creating reusable programs l Need to get input data and options from the user l l Sometimes, want completely new inputs l l …but often, want the same or similar input. Sometimes, typing the input is OK l l …often us, but sometimes others, or us later. …but often, want to use data in a file. Sometimes, output to the screen is OK l …but often, want the result to go into a file. BCHB 524 - Edwards 11
Interactive input_seq = raw_input("Type your codon: ") def complement(nuc): nucleotides = 'ACGT' complements = 'TGCA' i = nucleotides. find(nuc) if i >= 0: comp = complements[i] else: comp = nuc return comp def reverse. Complement(seq): seq = seq. upper() newseq = "" for nuc in seq: newseq = complement(nuc) + newseq return newseq print "Reverse complement: ", reverse. Complement(input_seq) BCHB 524 - Edwards 12
Command-line input import sys input_seq = sys. argv[1] def complement(nuc): nucleotides = 'ACGT' complements = 'TGCA' i = nucleotides. find(nuc) if i >= 0: comp = complements[i] else: comp = nuc return comp def reverse. Complement(seq): seq = seq. upper() newseq = "" for nuc in seq: newseq = complement(nuc) + newseq return newseq print "Reverse complement: ", reverse. Complement(input_seq) BCHB 524 - Edwards 13
Interactive and file input import sys input_seq = sys. stdin. read() def complement(nuc): nucleotides = 'ACGT' complements = 'TGCA' i = nucleotides. find(nuc) if i >= 0: comp = complements[i] else: comp = nuc return comp def reverse. Complement(seq): seq = seq. upper() newseq = "" for nuc in seq: newseq = complement(nuc) + newseq return newseq print "Reverse complement: ", reverse. Complement(input_seq) BCHB 524 - Edwards 14
File input only import sys seq_file = sys. argv[1] # MAGIC: open file, read contents, and remove whitespace input_seq = ''. join(open(seq_file). read(). split()) def complement(nuc): nucleotides = 'ACGT' complements = 'TGCA' i = nucleotides. find(nuc) if i >= 0: comp = complements[i] else: comp = nuc return comp def reverse. Complement(seq): seq = seq. upper() newseq = "" for nuc in seq: newseq = complement(nuc) + newseq return newseq BCHB 524 - Edwards print "Reverse complement: ", reverse. Complement(input_seq) 15
Input Summary l l l raw_input provides interactive values from the user (also copy-and-paste) sys. stdin. read() provides interactive or file-based values from the user (also copy-and-paste) sys. argv[1] provides command-line values from the user (also copy-and-paste) l l value can be a filename that provides user-input Terminal standard-input redirection "<" can be used to send a file's contents to raw_input or sys. stdin. read() BCHB 524 - Edwards 16
Output is easy… l l Just use print, right? Print statements go to the terminal's standard -output. l l l We can redirect to a file using ">" Errors still get printed to the terminal. We can also link programs together – standard-output to standard-input using "|" l Also, cat just writes its file to standard out BCHB 524 - Edwards 17
Connect reverse complement w/ codon counting… l Create and test rc. py from earlier slides: l l l Create and test codons. py from earlier slides: l l Sequence from standard-input Reverse complement sequence to standard-output Sequence from standard-input Count to standard-output Place example sequence in file: test. seq Execute: cat test. seq | python rc. py | python codons. py BCHB 524 - Edwards 18
In general l Windows and OS X have similar facilities l l Powerful mechanism for making reusable programs l l No knowledge of python required for use! Most bioinformatics software is used from the command-line w/ command-line arguments: l l cmd in windows, terminal in OS X Files provide sequence data, etc. I'll promote this style of program I/O. BCHB 524 - Edwards 19
Exercise 1 l Use NCBI Probe (“google NCBI Probe”) to look up PCR markers for your favorite gene l Write a command-line program to compute the reverse complement sequence for the forward and reverse primer. BCHB 524 - Edwards 20
Exercise 2 l Write a command-line program to test whether a PCR primer is a reverse complement palindrome. l l Such a primer might fold and self-hybridize! Test your program on at least the following primers: l l TTGAGTAGACGCGTCTACTCAA TTGAGTAGACGTCGTCTACTCAA ATATATAT ATCTATATGTAT BCHB 524 - Edwards 21
- Slides: 21