Introduction to DNA microarrays DTU January 2007 Hanne

Introduction to DNA microarrays DTU - January 2007 - Hanne Jarmer

Microarrays - The Concept Measure the level of transcript from a very large number of genes in one go CELL RNA

Why? RNA

How? gene m. RNA gene specific DNA probes labeled target

Microarrays - The Technologies Stanford-type Microarrays High-density

Stanford-type Microarrays

Stanford-type Microarrays Coating glass slides Deposition of probes Post-processing Hybridization

Spotting - Mechanical deposition of probes

16 -pin microarrayer

Microarrayer

Stanford microarrays CONTROL SAMPLE m. RNA c. DNA Cy 5 -c. DNA Cy 3 -c. DNA

Affymetrix Gene. Chip® oligonucleotide array • 11 to 20 oligonucleotide probes for each gene • On-chip synthesis of 25 mers • ~20, 000 genes per chip • good quality data • 280 -500 K features to play with

Photolithography in situ synthesis T T T A A A T Mask #2 Mask #1 T A T T A A AA A Spacers bound to surface with photolabile protection groups

Sample Preparation - Eberwine SAMPLE 42 C 2 h + Reverse Transcriptase 16 C 2 h + RNase H + Polymerase 37 C 6 h RNA ss. DNA T 7 70 C 10 min T 7 pol clean up ds. DNA + Biotin-labeled nucleotides a. RNA

Detection of Biotin (Affymetrix) Streptavidin Phycoerythrim = SAPE ( ) anti-SAPE Ig. G biotinylated anti-anti Ig. G

The Affymetrix Gene. Chip® A gene is represented like this: PM MM - Perfect Match (PM) - Mis. Match (MM) PM: CGATCAATTGCACTATGTCATTTCT MM: CGATCAATTGCAGTATGTCATTTCT

Nimble. Gen • 385, 000 to 2. 1 mill features • Long probes (up to 70 nt) • Service: -labelling -scanning -image analysis

Photolithography - Micromirrors

Analysis of Data Normalization: Linear or non-linear

Is it worth it? Number of known positives Known positives versus the total number of significantly affected genes at 5 different cutoffs in the Tnr. A experiment Qspline normalization Linear normalization Number of significantly affected genes

Analysis of Data Normalization: Linear or non-linear Statistical test: student’s t-test ANalysis Of VAriance (ANOVA) Analysis: Principal Component Analysis (PCA) Clustering and visualization

Tiling arrays are used for determation of genes, nc. RNAs, TF-binding sites, . . .

The DNA Array Analysis Pipeline Question Experimental Design Array design Probe design Sample Preparation Hybridization Buy Chip/Array Image analysis Normalization Expression Index Calculation Comparable Gene Expression Data Statistical Analysis Fit to Model (time series) Advanced Data Analysis Clustering Meta analysis PCA Classification Survival analysis Promoter Analysis Regulatory Network