Introduction The Central Dogma of Molecular Biology Cell

Outline 1 How we know DNA is the genetic material 2 Basic structure of

Transformation Of Bacteria Two Strains Of Streptococcus Rough Strain (Harmless) Capsules Smooth Strain (Virulent)

Transformation Of Bacteria The Griffith’s 1928 Experiment OUCH! + Control - Control Experimental ©

Avery, Mac. Leod and Mc. Carty � 1944 Avery, Mac. Leod and Mc. Carty repeated Griffith’s 1928 experiment with modifications designed to discover the “transforming factor” � After extraction with organic solvents to eliminate lipids, remaining extract from heat killed cells was digested with hydrolytic enzymes specific for different classes of macro molecules: Enzyme Transformation? Protease Yes Saccharase Yes Nuclease No © 2000 Timothy G. Standish

� The Hershey-Chase Experiement Hershey-Chase experiment showed definitively that DNA is the genetic material � Hershey and Chase took advantage of the fact that T 2 phage is made of only two classes of macromolecules: Protein and DNA H H 2 N C C CH 2 S CH 3 H O H 2 N C C OH Methionine CH 2 SH OH O OH Cysteine Some amino acids contain sulfur, thus proteins contain sulfur, but not phosphorous. HO P NH 2 O O OH H Nucleotides contain phosphorous, thus DNA contains phosphorous, but not sulfur. © 2000 Timothy G. Standish

S 35 T 2 grown in containing media incorporate S 35 into their proteins Using S 35 Bacteria grown in T 2 attach to bacteria and inject genetic material normal nonradioactive media When centrifuged, phage protein coats remain in the supernatant while bacteria form a pellet The supernatant is radioactive, but the pellet is not. Blending causes phage protein coat to fall off Did protein enter the bacteria? Is protein the genetic material?

P 32 T 2 grown in containing media incorporate P 32 into their DNA Using P 32 Bacteria grown in T 2 attach to bacteria and inject genetic material normal nonradioactive media When centrifuged, phage protein coats remain in the supernatant while bacteria form a pellet The pellet is radioactive, but the supernatant is not. Blending causes phage protein coat to fall off Did DNA enter the bacteria? Is DNA the genetic material?

A Nucleotide Adenosine Mono Phosphate (AMP) Phosphate HO H+ Nucleotide OH P O Base N H O 5’CH 2 4’ NH 2 H N O 1’ Sugar 3’ OH 2’ H OH N N Nucleoside

Purines NH 2 Adenine N N N O CH 3 (DNA) N Guanine NH N Thymine O NH 2 Uracil (RNA) NH N O N N Pyrimidines NH O NH 2 Cytosine N N O

Base Pairing Guanine And Cytosine N O - H N H e osin N N H ne ani - H Cyt N Gu N H + + + N -O N

Base Pairing CH N O + O N Thymine N N- N - H H + H Adenine N N 3 Adenine And Thymine

Base Pairing Adenine And Cytosine e osin Cyt H H H+ + H N N e n i n e d A N N -O N N

Base Pairing O H H N N H ne ani Gu N + e n i m Thy N O + N O N - - CH 3 Guanine And Thymine N H +

OH P HO N O CH 2 HN N N O OH H H 2 O N O NH 2 N HO P O O CH 2 O N O CH 2 N O H N 2 N H N N CH 2 O P HO H O OH H 2 O 5’Phosphate group HO O H BONE 3’Hydroxyl group P NH 2 HO P O HO O PHATE BACK NH CH 2 O N O O OH N O N H P 3’Hydroxyl group 3 H N N O O HO O NH 2 O CH E S B A S SUGAR-PHOS D N A 5’Phosphate group

B DNA Forms of the Double Helix G T A Minor groove Z DNA A T C G C A DNA 3. 9 nm 1 nm G C T A C G A T Major groove A T C G G C T A Minor groove Major groove A T C G T A A T 1. 2 nm 2. 8 nm G C T A C G A T G T A G C C A T G C 0. 34 nm 10. 4 Bp/turn +34. 6 o Rotation/Bp C G G C 0. 26 nm 0. 9 nm G C C G GC C G G C 6. 8 nm 0. 57 nm G C 11 Bp/turn +34. 7 o Rotation/Bp 12 Bp/turn -30. 0 o Rotation/Bp © 2000 Timothy G. Standish

Even More Forms Of DNA � C-DNA: – Exists only under high dehydration conditions – 9. 3 bp/turn, 0. 19 nm diameter and tilted bases B-DNA appears to be the – Occurs in helices lacking guanine most common form in – 8 bp/turn vivo. However, under some circumstances, � E-DNA: – Like D-DNA lack guanine alternative forms of DNA – 7. 5 bp/turn may play a biologically significant role. � P-DNA: � D-DNA: – Artificially stretched DNA with phosphate groups found inside the long thin molecule and bases closer to the outside surface of the helix – 2. 62 bp/turn © 2000 Timothy G. Standish

Denaturation and Renaturation � Heating double stranded DNA can overcome the hydrogen bonds holding it together and cause the strands to separate resulting in denaturation of the DNA � When cooled relatively weak hydrogen bonds between bases can reform and the DNA renatures on i t a r u t na De Re na ATGAGCTGTACGATCGTG tur Denatured DNA ATGAGCTGTACGATCGTG TACTCGACATGCTAGCAC Double stranded DNA ati o n ATGAGCTGTACGATCGTG TACTCGACATGCTAGCAC Single stranded DNA Double stranded DNA © 2000 Timothy G. Standish

Denaturation and Renaturation � DNA with a high guanine and cytosine content has relatively more hydrogen bonds between strands � This is because for every GC base pair 3 hydrogen bonds are made while for AT base pairs only 2 bonds are made � Thus higher GC content is reflected in higher melting or denaturation temperature ACGAGCTGCACGAGC TGCTCGACGTGCTCG ATGATCTGTAAGATC TACTAGACATTCTAG 67 % GC content High melting temperature 33 % GC content Low melting temperature ATGAGCTGTCCGATC TACTCGACAGGCTAG 50 % GC content - Intermediate melting temperature © 2000 Timothy G. Standish

Determination of GC Content � Comparison of melting temperatures can be used to determine the GC content of an organisms genome � To do this it is necessary to be able to detect whether DNA is melted or not � Absorbance at 260 nm of DNA in solution provides a means of determining how much is single stranded � Single stranded DNA absorbs 260 nm ultraviolet light more strongly than double stranded DNA does although both absorb at this wavelength � Thus, increasing absorbance at 260 nm during heating indicates increasing concentration of single stranded DNA © 2000 Timothy G. Standish

Determination of GC Content 1. 0 Tm is the temperature at which half the DNA is melted OD 260 Single stranded DNA Relatively low GC content Relatively high GC content Tm = 75 o. C Tm = 85 o. C Double stranded DNA 0 65 70 75 80 85 Temperature (o. C) 90 95 © 2000 Timothy G. Standish

GC Content Of Some Genomes Organism Homo sapiens % GC 39. 7 % Sheep Hen Turtle 42. 4 % 42. 0 % 43. 3 % Salmon Sea urchin E. coli Staphylococcus aureus 41. 2 % 35. 0 % 51. 7 % 50. 0 % Phage l Phage T 7 55. 8 % 48. 0 % © 2000 Timothy G. Standish

� The Hybridization bases in DNA will only pair in very specific ways, G with C and A with T � In short DNA sequences, imprecise base pairing will not be tolerated � Long sequences can tolerate some mispairing only if - G of the majority of bases in a sequence exceeds the energy required to keep mispaired bases together � Because the source of any single strand of DNA is irrelevant, merely the sequence is important, DNA from different sources can form double helix as long as their sequences are compatible � Thus, this phenomenon of base pairing of single stranded DNA strands to form a double helix is called hybridization as it may be used to make hybrid DNA composed of strands which came from different sources © 2000 Timothy G. Standish

Hybridization DNA from source “X” CTGATGGTCATGAGCTGTCCGATCAT TACTCGACAGGCTAG Hybridization TACTCGACAGGCTAG DNA from source “Y” ©

Hybridization � Because DNA sequences will seek out and hybridize with other sequences with which they base pair in a specific way much information can be gained about unknown DNA usingle stranded DNA of known sequence � Short sequences of single stranded DNA can be used as “probes” to detect the presence of their complimentary sequence in any number of applications including: – – Southern blots Northern blots (in which RNA is probed) In situ hybridization Dot blots. . . � In addition, the renaturation or hybridization of DNA in solution can tell much about the nature of organism’s genomes © 2000 Timothy G. Standish

� An Reassociation Kinetics organism’s DNA can be heated in solution until it melts, then cooled to allow DNA strands to reassociate forming double stranded DNA � This is typically done after shearing the DNA to form many fragments a few hundred bases in length � The larger and more complex an organisms genome is, the longer it will take for complimentary strands to bum into one another and hybridize � Reassociation follows second order kinetics © 2000 Timothy G. Standish

� The Reassociation Kinetics following equation describes the second order rate kinetics of DNA reassociation: Concentration of single stranded DNA after time t Initial concentration of single stranded DNA C 1 = Co 1 + k. Cot Second order rate constant (the important thing is that it is a constant) Co (measured in moles/liter) x t (seconds). Generally graphed on a log 10 scale. Cot 1/2 is the point at which half the initial concentration of single stranded DNA has annealed to form double -stranded DNA © 2000 Timothy G. Standish

Reassociation Kinetics 1. 0 Fraction remaining singlestranded (C/Co) 0. 5 0 Higher Cot 1/2 values indicate greater genome complexity Cot 1/2 10 -4 10 -3 10 -2 10 -1 1 102 Cot (mole x sec. /l) 103 104 © 2000 Timothy G. Standish

Reassociation Kinetics 1. 0 Prokaryotic DNA Fraction remaining Repetitive single. DNA stranded (C/Co) 0. 5 Unique sequence complex DNA Eukaryotic DNA 0 10 -4 10 -3 10 -2 10 -1 1 102 Cot (mole x sec. /l) 103 104 © 2000 Timothy G. Standish