Internship epigenetic Internship DNA methylation of DNA Objective
Internship epigenetic Internship DNA methylation of λ-DNA Objective: To represent de novo methylation of DNA Model for epigenetic changes in DNA Me Cytosin Methylase Methyltransferases transfer a methyl group to the DNA 1
Internship epigenetic Internship DNA-Methylation of λ-DNA Materials: Model-DNA DNA-Methyltransferase λ-DNA Cp. G-Methyltransferase Restriction enzyme Cla. I 2
Intership epigenetic DNA methylation of λ-DNA Material: λ-DNA (non-methylated λ-DNA) Lambda is a bacteriophage of Escherichia coli. The double-stranded DNA of the virus is linear and has a length of 48502 bp. The genomic DNA of the phage λ is propagated in E. coli strain GM 2163 and isolated from it. The λ-DNA is unmethylated because the strain GM 2163 has a mutation in the gene for Cp. G methylase which means that the bacteria can`t conduct Cytosine methylation reactions. 3
Intership epigenetic DNA methylation by methyltransferase 1. „Methylases, can play the role of a “molecular vaccine” by defending the genome against parasitism by a restriction-modification gene complex” (Takahashi et la. 2002). 4
Intership epigenetic DNA methylation by Cp. G methyltransferase e e The Cp. G methylases of eukaryotes (e. g. human Cp. G methylase) transfers a methyl group to position 5 of the cytosine within the DNA sequence CG (also called Cp. G). The restriction enzyme Cla. I is methylation-sensitive and does not cut the recognition sequence ATCGAT if it is methylated at the C. 5 https: //www. neb. com/tools-and-resources/selection-charts/dam-dcm-and-cpg-methylation https: //pubs. niaaa. nih. gov/publications/arcr 351/6 -16. htm
Intership epigenetic DNA methylation by Cp. G methyltransferase Epigenetic role in the methylation of Cp. G sequences ("Cp. G islands") in promoter regions. 6
Intership epigenetic Experiment Instruction 1. Methylation reaction with Cp. G methylase You will find filled tubes with the following designations prepared in ice: L = λ-DNA, unmethylated CMT = Cp. G-methylase SAM = S-Adenosyl-methionine B 2 = 10 X NEB-buffer 2 H 2 O = destilled water 7
Intership epigenetic 1. DNA methylation with Cp. G methylase 1. 1 Label an empty tube with “LC“ (LC = λ-DNA Cp. G methylated) 1. 2 Fill the tube LC according to following pipetting scheme: Application Component μl λ-DNA unmethylated (L), 0, 3 μg/μl Λ-DNA unmethylated S-adenosyl-methionine-dilution (SAM), 1, 6 m. M H 2 O distilled Reaction volume Incubation Inactivation 5 min on ice and centrifuge briefly 8
Intership epigenetic 2. Restriction with Cla. I of Cp. G-methylated λ-DNA You will find filled tubes with the following designations on ice: L = λ-DNA unmethylated LC = λ-DNA, Cp. G methylated C = Cla. I CB = 10 X cut smart buffer H 2 O = distilled water 9
Intership epigenetic 2. Restriction with Cla. I of Cp. G-methylated l-DNA 2. 1 Label 3 empty tubes with K, 1 and 2 2. 2 Pipette according the following pipetting scheme: Tubes team CMT Compound λ-DNA unmethylated (L), 0, 3 μg/μl λ-DNA methylated (LC), 0, 075 μg/μl H 2 O distilled Reaction volume Incubation 10
Intership epigenetic 3. Electrophoresis 4 groups are working together in one gel cassette. 3. 1 Open the gel cassette and moisten the pockets with distilled water. 3. 2 Excess water is removed. 11
Intership epigenetic 3. Electrophoresis 3. 3 Pipette 4 μl loading buffer to your samples (K, 1, 2). 3. 4 Pipette into the pockets of the gel 5 μl of - kontrol (K), - samples 1 and 2 and once 5 μl marker (M) in the middle pocket of the gel 3. 5 Start the electrophoresis at 180 V. 12
Intership epigenetic Cp. G methylation and Cla. I restriction Agarose gel electrophoresis - overview GR 1 K 1 GR 3 GR 2 2 K 1 2 M K 1 GR 4 2 K Gel Flash-Gel: 1, 2 % 12+1, 180 Volt M = Lambda-DNA /Eco. RI plus Hind. III Marker, ready-to-use 1 2
Restriction of Cp. G-methylated and non-methylated λ-DNA with Cla. I Cp. G-methylated Restriction enzyme Cla. I Methyl group on Cp. G 5‘ … ACAACATCGATAATGAATCAT … 3‘ Sequence for Cla. I to recognize and cut Cp. G-unmethylated Restriction enzyme Cla. I 5‘ … ACAACATCGATAATGAATCAT … 3‘ Sequence for Cla. I to recognize and cut
Result of the methylation experiment
P 2 (Cp. G+. Cla. I) P 1 (Cp. G-. Cla. I) P 2 (Cp. G++Cla. I P 1 (Cp. G- +Cla. I K 1 (Cp. G-) M Experimental conditions: Methylation reaction 90 min. ; 37 °C Inactivation: 20 min. , 65 °C; Cla. I-restriction: 30 min. , 37 °C +
- Slides: 16