Interleukin1 Is a Paracrine Inducer of FGF 7

  • Slides: 7
Download presentation
Interleukin-1α Is a Paracrine Inducer of FGF 7, a Key Epithelial Growth Factor in

Interleukin-1α Is a Paracrine Inducer of FGF 7, a Key Epithelial Growth Factor in Benign Prostatic Hyperplasia Dipak Giri, Michael Ittmann The American Journal of Pathology Volume 157 Issue 1 Pages 249 -255 (July 2000) DOI: 10. 1016/S 0002 -9440(10)64535 -X Copyright © 2000 American Society for Investigative Pathology Terms and Conditions

Figure 1 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002

Figure 1 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002 -9440(10)64535 -X) Copyright © 2000 American Society for Investigative Pathology Terms and Conditions

Figure 2 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002

Figure 2 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002 -9440(10)64535 -X) Copyright © 2000 American Society for Investigative Pathology Terms and Conditions

Figure 3 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002

Figure 3 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002 -9440(10)64535 -X) Copyright © 2000 American Society for Investigative Pathology Terms and Conditions

Figure 4 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002

Figure 4 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002 -9440(10)64535 -X) Copyright © 2000 American Society for Investigative Pathology Terms and Conditions

Figure 5 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002

Figure 5 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002 -9440(10)64535 -X) Copyright © 2000 American Society for Investigative Pathology Terms and Conditions

Figure 6 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002

Figure 6 The American Journal of Pathology 2000 157249 -255 DOI: (10. 1016/S 0002 -9440(10)64535 -X) Copyright © 2000 American Society for Investigative Pathology Terms and Conditions

FGF 9 and FGF 20 Maintain the StemnessFGF 9 and FGF 20 Maintain the Stemness
PCR primer design ATTGCCACGTTGACGGTCAG CACGATTTCCGGAAGTAC Inducer IPTG lactosePCR primer design ATTGCCACGTTGACGGTCAG CACGATTTCCGGAAGTAC Inducer IPTG lactose
Next lecture InductionSignaling Requirements of inducer and responderNext lecture InductionSignaling Requirements of inducer and responder
Cut lactose and xgal Inducer IPTG lactose RestrictionCut lactose and xgal Inducer IPTG lactose Restriction
Inducer IPTG lactose Cut lactose and xgal ReporterInducer IPTG lactose Cut lactose and xgal Reporter
Pharmacology Cytochrome P 450 system Pharmacology CYP InducerPharmacology Cytochrome P 450 system Pharmacology CYP Inducer