Informatics Research Mini Assembler Software Project B Seq

Informatics Research Mini Assembler Software Project B: Seq. An David Weese and Prof. Knut Reinert

Seq. An – The C++ Sequence Analysis Library Informatics Research Sequences Alignments - strings - structured sequences - gapped sequences - alterators - alignment data structures - dynamic Programming - alignment heuristics - multidimensional chaining Searching - (structural) align. graphs - word graphs - probabilistic automata - trees Probabilis. Algorithms - profiles, weight matrices - HMM, SCFG - p-value computations -… - alphabets - scoring schemes - file formats - base pair probabilities - - q-gram hashes - (enhanced) suffix array - suffix trees - lazy indices, compress. ind. Graphs - exact/approximate - search heuristics - filtering - motif search Biologicals Indices - FASTA - g. QUASAR, SWIFT, . . - MEME, PROJECTION, … -… Integration Miscellan. - using external tools - STL - LEDA and Boost graphs - friend libraries (LISA) - allocators - OS access and support - helper data struc. and algorithms

DNA Sequencing Shotgun DNA Sequencing (Technology) DNA target sample Informatics Research SHEAR SIZE SELECT (LIBRARY) Reads (Mate Pair) LIGATE & CLONE Primer SEQUENCE Vector

Shotgun DNA Sequencing Informatics Research Randomly Sample (“Shotgun”) Fragments Unknown “Target” DNA Sequence Avg. Length Avg. Error UNKNOWN ORIENTATION l SEQUENCING ERRORS l INCOMPLETE COVERAGE l REPEATS l Layout Consensus 550 1 -2% Ordered Contigs Scaffold

Project Mini Assembler Informatics Research Input: Reads (mate pairs), generated by a simulator Goal: Construct large scaffolds to obtain a good assembly (N 50 measure)

Project Mini Assembler Whole Genome Shotgun Assembly Pipeline Screener Overlapper Unitigger Scaffolder Repeat. Rez Consensus Informatics Research

Project Mini Assembler Whole Genome Shotgun Assembly Pipeline Screener Overlapper Unitigger Scaffolder Repeat. Rez Consensus Informatics Research Mask known and „de novo“ repeats Task: Build a repeat screener to help the Overlapper

Project Mini Assembler Whole Genome Shotgun Assembly Pipeline Screener Overlapper Find overlaps between reads A Unitigger B Scaffolder Task: Repeat. Rez Construct an overlapper module to compute overlaps with affine gap costs. Consensus Informatics Research

Project Mini Assembler Informatics Research Whole Genome Shotgun Assembly Pipeline Screener Overlapper Unitigger Compute consistent sub-assemblies (unitigs) Scaffolder Repeat. Rez Task: Consensus Construct overlap graph Construct a spanning tree based layout

Project Mini Assembler Whole Genome Shotgun Assembly Pipeline Informatics Research Mated fragments Screener unitigs Overlapper scaffold Unitigger Scaffolder Build Scaffolds Repeat. Rez Task: Consensus Contruct mate pair contig graph Construct scaffold with greedy approach

Project Mini Assembler Whole Genome Shotgun Assembly Pipeline Screener Stones Overlapper Confirming o-path Unitigger Scaffolder Repeat. Rez Consensus “Anchored” mate and confirming overlap path Fill Gaps Task: Extend contigs using mates and overlaps Informatics Research

Project Mini Assembler Informatics Research Whole Genome Shotgun Assembly Pipeline Screener Overlapper Unitigger Scaffolder AACGTGCATTAACTCGCGCAACTG TTCGGGTTGAACGTGCATTAACTCG TTCGGGTTGAACGTGTATTAAATCGCGCAACTG GGGTTGAACGTGCATTAAATCGCGCAACTG TTCGGGTTGAACGTGCATTAAATCGCGCAACTG Repeat. Rez Consensus Compute consensus sequence and N 50 score

Names to Tasks Informatics Research Task Repeat screener (1) Overlapper (2) Overlap graph const. (3) MST based layout (4) Mate pair graph (5) Scaffolder (6) Repeat Resolution (7) Consensus, N 50 (8) Student

Tasks Informatics Research Preferable requirements: • C/C++ skills • „C++ für Fortgeschrittene“ block seminar (6. 4. - 9. 4. ) Your work: • Collaborate and develop a module interface • Make use of Seq. An - C++ Sequence Analysis Library (www. seqan. de) • Implement your module in C++ • Document your code • Present your results Material: • Assembly lecture notes of „Alg. Bioinformatik“, Reinert WS 07/08 • Links and documents on the homepage

Schedule Informatics Research Seminar block 1 (2. 4. ) • Introduction to principles of software design • Tools (IDE, Debugger, Profiler, Bug Tracker, SVN, …) Seminar block 2 (14. 4. - 17. 4. ) • Seq. An tutorial (Sequences, Alignments, Graphs, Indices) • Assign names to tasks Make and present your plan (until 27. 4. ) • Prepare a presentation • What are your data types and interfaces to other modules? • What algorithms you want to use? • What do you use from Seq. An what do you implement new? Start Working Present your results, write a final report (until 8. 6. )

End of Talk Informatics Research Questions? weese@inf. fu-berlin. de