Identifying the Correlation of Single Nucleotide Polymorphisms in

- Slides: 1
Identifying the Correlation of Single Nucleotide Polymorphisms in Determining Genotype Lindsay Moore and Karleigh Pepper BIOL 250, Longwood University Results Background 5 a Ladder • Single Nucleotide Polymorphisms (SNPs) are the most common type of genetic variation within people. • SNPs are a difference in a single nucleotide • SNPs are important because they can influence many diseases and including cancer (1). • Associations between SNPs and hereditary genetic disorders (2). • By analyzing the SNPs in the DNA sequence, we will be able to predict our genotype for a specific trait. Blue/Brown Eye Color: ● Homozygous ○ Nucleotide GG Clin. Var Website: 3' TTAAATGTC 5' Sample SNP: 3' TTAAGTGTC 5' 500/517 bp Figure 3: Shows the results of gel electrophoresis with the sample Figure 2: Shows a section from the trace file containing the SNP. Straight/Curly Hair: ● Homozygous o Nucleotide C ● Clin. Var Website: 3' TAAAGACTC 5' ● Sample SNP: 3’ TAAACACTC 5’ Figure 4: shows the section of DNA that contains the SNP being tested Hair Type Sample Figure 1: shows an image of a Single Nucleotide Polymorphism in s sequence (3). Specific Aim Research Question: Can SNPs determine the genotype of Blue/Brown eye color or Straight/Curly hair? Hypothesis: When SNPs are analyzed and detected, then a homozygous genotype will be detected for Blue/Brown eyes and Straight/Curly hair. Methods Predict Genotypes Polymerase Chain Reaction (PCR) PCR product or Amplicon SNP Analysis Collection of Cheek Cells TGAGACTGGCCCATGAGCTCCAG AGCAGGAAGATATAACTTACTCAA CTCTAAACACTCCAGTTCCTGGCA TAGTGTTGAGAAATAGCTGGTACT CTGGGGATATTAAC Figure 5: is a section of the analysis results from Eurofins Genomics. The highlighted section is what was used to determine the location of the SNP. DNA Ladder Approximately 400 base pairs Figure 6: shows the DNA ladder and the sample tested for hair type. Conclusions • Genotypes ○ Eye Color: homozygous ○ Hair Type: homozygous • Limitations: o Visible genotype for the selected traits o Sample Size • SNPs can be used to determine genotype for other traits • Both genotypes were homozygous References 1. Wang H-B, Ma L-H, Zhang T, Huang K-C, Zhao Y-D, Liu T-C. 2020. Simple and accurate Gel Electrophoresis DNA Sequencing visual detection of single nucleotide polymorphism based on colloidal gold nucleic acid strip biosensor and primer-specific PCR. Analytica Chimica Acta. 1093: 106– 114. 2. Islam MJ, Khan AM, Parves MR, Hossain MN, Halim MA. 2019. Prediction of Deleterious Non-synonymous SNPs of Human STK 11 Gene by Combining Algorithms, Molecular Docking, and Molecular Dynamics Simulation. Scientific Reports. 9(1). 3. https: //www. openpr. com/news/406308/global-single-nucleotide-polymorphism-snpmarket-2017 -beckman-coulter-qiagen-luminex-corporation-enzo-life-sciences-bio-radsequenom-genscript. html