Hybridization of Nucleic Acids DNA 1 DNA 2

Hybridization of Nucleic Acids DNA 1 DNA 2 RNA Probe Northern hybridization Southern hybridization Juang RH (2004) BCbasics

Preparation of Traditional Nucleic Acid Probe Amino acid sequence GLY-ASP-GLU-SER-VAL-LEU----GGG-GAC-GAG-TCC-GTT-CTC--- * * Nucleic acid sequence The nucleic acid sequence is Deduced from amino acid sequence Chemical synthesis * * Codon degeneracy Synthesizing oligonucleotide PROBE: GGGGACGAGTCCTCCGTTCT Juang RH (2004) BCbasics

Probe is labeled with radioactive 32 P Hybridization DNA denaturation Target gene Single colony Lysed Juang RH (2004) BCbasics

Colony Is Screened by Hybridization with Probe Colony hybridization Transferring … Collect filter paper Dissolve cell Autoradiography DNA denatured Add probe Juang RH (2004) BCbasics Cover with filter paper

Biochip Based on Hybridization Sample DNA Complementary DNA hybridize Biochip Each spot contains known DNA Signal appears Schena (2000) Microarray Biochip Technology, p. A 31 Juang RH (2004) BCbasics

The Genetic Code 4 Initiation and termination Codons – Initiation codon: AUG – Termination codons: UAA, UAG, UGA 4 Degeneracy: partial and complete 4 Ordered 4 Nearly Universal (exceptions: mitochondria and some protozoa)

Key Points 4 Each of the 20 amino acids in proteins is specified by one or more nucleotide triplets in m. RNA. (20 amino acids refers to what is attached to the t. RNAs!) 4 Of the 64 possible triplets, given the four bases in m. RNA, 61 specify amino acids and 3 signal chain termination. (have no t. RNAs!)

Key Points 4 The code is nonoverlapping, with each nucleotide part of a single codon, degenerate, with most amino acids specified by two to four codons, and ordered, with similar amino acids specified by related codons. 4 The genetic code is nearly universal; with minor exceptions, the 64 triplets have the same meaning in all organisms. (this is funny)

Do all cells/animals make the same Repertoire of t. RNAs?

The Genetic Code

The Wobble Hypothesis: Base-Pairing Involving the Third Base of the Codon is Less Stringent.

Base-Pairing with Inosine at the Wobble Position

In molecular biology, a wobble base pair is a non-Watson. Crick base pairing between two nucleotides in RNA molecules. The four main wobble base pairs are guanine-uracil, inosine-adenine, and inosinecytosine (G-U, I-A and I-C). The thermodynamic stability of a wobble base pair is comparable to that of a Watson-Crick base pair. Wobble base pairs are fundamental in RNA secondary structure and are critical for the proper translation of the genetic code.

Suppressor Mutations 4 Some mutations in t. RNA genes alter the anticodons and therefore the codons recognized by the mutant t. RNAs. 4 These mutations were initially detected as suppressor mutations that suppressed the effects of other mutations. 4 Example: t. RNA mutations that suppress amber mutations (UAG chain-termination mutations) in the coding sequence of genes.

Making a (UAG) Mutation

Translation of an amber (UAG) Mutation in the Absence of a Suppressor t. RNA

Translation of an amber Mutation in the Presence of a Suppressor t. RNA Note it is amber su 3…why? ? ? ? ?

Translation of an amber Mutation in the Presence of a Suppressor t. RNA If there was a single t. RNATyr gene, then could one have a amber supressor of it?

Fig 1

New Base

Are the proteins produced a pure reflection of the m. RNA sequence? ? t. RNA environment, protein modifications post-translationally

Good things to Know RNApol II TATAA CCATGG (Nco I site and Kozak Rule) ATG AGGT…. splice GT……………A………polypyrimidine AG Poly. A recog sequence AATAAA The Reasons why ATG is a single codon and TGG is a single codon.

SELEX yields a functional binding site. A, COS 7 cells were transfected in triplicate with either p. EBG or increasing concentrations of BENwt (250, 500, and 1000 ng) and either p 81 TKluc (TK) luciferase reporter or p 81 TKluc-WT 3 X (WT 3 X). The luciferase values are reported as relative luciferase activity normalized to the amount of total protein. -Fold decrease in activity is measured relative to the basal transcriptional activity observed with p. EBG empty expression vector alone. Western blot with anti-GST antibody shows dosedependent expression of GST-BEN.

B, COS 7 cells were transfected in triplicate with either p. EBG or BENwt (1000 ng of each) and with either TK, or WT 3 X or Mut 3 X (600 ng of each) and the Renilla construct (p. RL-TK).