Human Body Organization Levels 1 Chemical 2 Cellular

Human Body Organization Levels 1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic

Chemical Level • Elements • H • C • O • Compounds • Na. Cl • KCl • Ions • Na+ • K + • Cl • Ca++ • Mg++ • Molecules • O 2 • C 6 H 12 O 6 • Macromolecules • Proteins • amino acids • Lipids • fatty Acids • Carbohydrates • monosaccharides • Nucleic Acids • nucleotides

Cellular Level Chromatin

Tissue Level • Epithelial Tissue • Connective Tissue • Muscular Tissue • Nervous Tissue

Organ Level Gastrointestinal Tract 1. Mouth 2. Pharynx 3. Esophagus 4. Stomach 5. Small Intestine 6. Large Intestine Accessory Structures 1. Teeth 2. Tongue 3. Salivary Glands 4. Liver 5. Gallbladder 6. Pancreas

Organ System Level

Organismic Level Darwin sails around the world and in South America is puzzled by the absence of rabbits. Instead he finds these rabbit-like Patagonian Hares or Mara (Dolichotis patagonum) that are not rabbits but have similar characteristics as rabbits. He postulates that they must have evolved just like rabbits because of their similar environments

Animal Cell Chromatin

DNA (deoxyribonucleic acid) Bases/Base Pairs Nucleotides 1. 2. 3. Nitrogenous Base Pairs: A–T C–G

DNA Organization • Chromatin organized: • DNA • Histones One Duplicated Chromosome

Human Chromosomes A Pair of Duplicated Chromosomes Autosomes Sex Chromosomes 46 individual chromosomes / 23 pairs of chromosomes • they are the same - code for same type of trait • they are different - code for different version of trait

Understanding the Numbers • 1 chromosome is 1 large DNA molecule • a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG • 1000 -2000 genes per chromosome • ~25, 000 - 30, 000 genes per human genome

DNA Functions • Pass on Genetic Material • Replication • Mitosis • Meiosis • Protein Synthesis • Transcription • Translation

Mitosis

Replication • Making an exact copy of DNA • Occurs just prior to cell division • Double helix unwinds • DNA polymerase adds bases • Two exact copies are made

Embryongenesis - Week 1 Blastocyst Inner Cell Mass (Embryonic Stem Cells) Pluripotent Stem Cells

Embryogenesis Week 2 Embryonic Germ Cell Layers: • Endoderm • Mesoderm • Ectoderm Multipotent Stem Cells

Cell Migration Growth Cone

Radial Glia • Act like scaffolding to assist movement of neurons during development

Differentiation

Schizophrenia Abnormality Hippocampal Pyramidal Cell Disorganization

Neurobehavioral Hypothesis • Maternal/Fetal Evidence: • extensive maternal bleeding • prolonged labor • delivery complications • low birth weight • low head circumference • body length: body weight • multiparity • Anectodal Evidence • Dutch births during WWII • Season of birth effect • higher for winter pregnancies • parallel with virus exposure

Protein Synthesis • Transcription • DNA to m. RNA • Translation • m. RNA to Protein

From Gene to Protein DNA RNA Protein

Genetic Code Codons three base code Code for specific amino acids

Point Mutation Spontaneous Mutation Environmental Insult • Mutagenesis • Carcinogenesis Mutation is corrected

Point Mutation is not corrected Mutation is corrected

Sickle-Cell Anemia Mutation

Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: • one from mom • one from dad If one is bad, this increases your chance of getting the disease

Cancer in Women

Lung Cancer