Hidden Markov Models p HMM too Markov Chain
- Slides: 13
Hidden Markov Models p. HMM too!
Markov Chain, Markov Model • Markov Chain: describes a meaningful process that can be in any one of a number of states at any given time, Markov Chain: Jeff plays guitar. Markov Model: noun verb noun
Markov Model: noun verb noun Hidden Markov Model. . . probabilistic model of a group of Markov Chains, Markov Chain(1): Markov Chain(2): Markov Chain(3): Hidden Markov Model: Jeff plays guitar. Jeff plays flamenco guitar poorly. (noun) (verb) (adjective) (noun) (adverb)
Profile Hidden Markov Model • A Hidden Markov Model built to describe a certain set of Markov Chains, that is used to identify additional, related chains. . . Hidden Markov Model: p(Sentence) = p(Words in sentence)|(n)(v)(a)(n)(a) x p(Word order)(n)(v)(a)(n)(a)
GC Rich vs. Normal NNNNNRRRRNNNNNNNNNRRRRRRRNNNN TTACTTGACGCCAGAAATGTATATTTGGTAACCCGACGCTAA 60% AT, 40%GC Are the red regions really GC-rich (R)?
Training Based on real data, the relative frequencies observed for base identification given genomic location (state probablilties). . Based on real data, the probability of “entering”, or leaving a GC-rich or normal state… N - N (0. 9) C - C (0. 8) N - R (0. 1) C - R (0. 2)
HMM p(ACGC) N A 0. 3 T 0. 3 G C N A 0. 3 T 0. 3 0. 2 G 0. 2 C 0. 9 0. 2 0. 1 R N A 0. 3 T 0. 3 0. 2 G 0. 2 C 0. 2 0. 9 0. 2 0. 1 R R A 0. 1 T 0. 1 G 0. 4 C 0. 4 0. 8 p(ACGC|NNNN)p(NNNN) = 0. 00175 0. 8 C 0. 4 p(ACGC|NRRR)p(NRRR) = 0. 00123
HMM p(ACGCC) N A 0. 3 T 0. 3 G C N A 0. 3 T 0. 3 0. 2 G 0. 2 C 0. 9 0. 2 0. 1 R N A 0. 3 T 0. 3 0. 2 G 0. 2 C 0. 2 0. 9 0. 2 0. 1 R A 0. 1 T 0. 1 G 0. 4 C 0. 4 0. 8 p(ACGCC|NNNNN)p(NNNNN) = 0. 000315 0. 8 C 0. 4 p(ACGC|NRRRR)p(NRRRR) = 0. 0004
Figure 1
Figure 2
Figure 3
HMM-Others
- Hidden markov models
- A revealing introduction to hidden markov models
- A revealing introduction to hidden markov models
- Kahoot quantifiers
- Hidden markov chain
- Kpuska
- Hidden markov chain
- Hidden markov model beispiel
- Hidden markov model rock paper scissors
- Hidden markov model
- Hidden markov model tutorial
- Hidden markov map matching through noise and sparseness
- Sequence of food chain
- Too broad and too narrow examples