Generating Multiple Sequence Alignments with Clustal W Clustal

  • Slides: 21
Download presentation
Generating Multiple Sequence Alignments with Clustal. W

Generating Multiple Sequence Alignments with Clustal. W

Clustal. W: creating a multiple sequence alignment • You identify sequences to align •

Clustal. W: creating a multiple sequence alignment • You identify sequences to align • Get Fasta sequences and copy and paste into window or put all sequences in one document and attach (example: copy and paste into one Word document)

Clustal. W: Creating the initial alignment

Clustal. W: Creating the initial alignment

Clustal. W: The Alignment Report

Clustal. W: The Alignment Report

Clustal. W: The Alignment Report

Clustal. W: The Alignment Report

Clustal. W: The Alignment Report

Clustal. W: The Alignment Report

Clustal. W: The Alignment Report

Clustal. W: The Alignment Report

Clustal. W: Jalview

Clustal. W: Jalview

Clustal. W: Jalview

Clustal. W: Jalview

Clustal. W: Jalview

Clustal. W: Jalview

Clustal. W: creating a phylogenetic tree • Clustal. W can only assemble a phylogenetic

Clustal. W: creating a phylogenetic tree • Clustal. W can only assemble a phylogenetic tree from multiple sequence alignments generated by Clustal. W

Clustal. W: Making a Phylogenetic Tree

Clustal. W: Making a Phylogenetic Tree

Clustal. W: Making a Phylogenetic Tree

Clustal. W: Making a Phylogenetic Tree

Clustal. W: Making a Phylogenetic Tree

Clustal. W: Making a Phylogenetic Tree

Clustal. W: Making a Phylogenetic Tree Must use Clustal aligned sequences & include “Clustal”

Clustal. W: Making a Phylogenetic Tree Must use Clustal aligned sequences & include “Clustal” line

Clustal. W: Making a Phylogenetic Tree

Clustal. W: Making a Phylogenetic Tree

Clustal. W: Making a Phylogenetic Tree • Phylogram: tree that provides an estimate of

Clustal. W: Making a Phylogenetic Tree • Phylogram: tree that provides an estimate of a phylogeny, where the branch lengths are proportional to the amount of evolutionary divergence. • Cladogram: tree that provides an estimate of phylogeny where the branches are of equal length: therefore cladograms indicate common ancestry, but do not reflect amount of evolutionary time separating sequences.

Clustal. W: The Phylogram Tree

Clustal. W: The Phylogram Tree

Clustal. W: The Cladogram Tree

Clustal. W: The Cladogram Tree

Clustal. W: Practice Weblem • Align the refseq protein sequences of Arabidopsis thaliana RDR

Clustal. W: Practice Weblem • Align the refseq protein sequences of Arabidopsis thaliana RDR 6, Schizosaccharomyces pombe Rdp 1, Caenorhabditis elegans rrf-2, Caenorhabditis elegans rrf-3, and Aspergillus fumigatus Sad-1 using Clustal. W. Print out this alignment. • Generate and print out a phylogram and cladogram using this alignment. • Given what you know about the evolutionary relationships between these organisms, does the phylogram and cladogram make sense? Why or why not?

Multiple Sequence Alignments Clustal Omega Susan Parrish McMultiple Sequence Alignments Clustal Omega Susan Parrish Mc
Multiple Sequence Alignments Clustal Omega Susan Parrish McMultiple Sequence Alignments Clustal Omega Susan Parrish Mc
Sequence Alignments Revisited Scoring nucleotide sequence alignments wasSequence Alignments Revisited Scoring nucleotide sequence alignments was
Introduction to Bioinformatics Sequence Alignments Sequence Alignments CornerstoneIntroduction to Bioinformatics Sequence Alignments Sequence Alignments Cornerstone
Multiple sequence alignment Why we do multiple alignmentsMultiple sequence alignment Why we do multiple alignments
Multiple Sequence Alignment Clustal W TCoffee Ka KsMultiple Sequence Alignment Clustal W TCoffee Ka Ks
Clustal for Protein Multiple Sequence Alignment Des HigginsClustal for Protein Multiple Sequence Alignment Des Higgins
Multiple Sequence Alignment Overview of Clustal W ProcedureMultiple Sequence Alignment Overview of Clustal W Procedure
Lecture 16 Generating Functions Generating Functions Basically generatingLecture 16 Generating Functions Generating Functions Basically generating
Generating Dunning Letters Concept Generating Dunning Letters GeneratingGenerating Dunning Letters Concept Generating Dunning Letters Generating
CS 177 Sequence Alignment Classification of sequence alignmentsCS 177 Sequence Alignment Classification of sequence alignments
Class 5 Multiple Sequence Alignment Multiple sequence alignmentClass 5 Multiple Sequence Alignment Multiple sequence alignment
CS 5263 Bioinformatics Multiple Sequence Alignment Multiple SequenceCS 5263 Bioinformatics Multiple Sequence Alignment Multiple Sequence
Class 5 Multiple Sequence Alignment Multiple sequence alignmentClass 5 Multiple Sequence Alignment Multiple sequence alignment
Multiple sequence alignment Why multiple sequence alignment TheMultiple sequence alignment Why multiple sequence alignment The
Multiple Sequence Alignment By Yuan Li Multiple SequenceMultiple Sequence Alignment By Yuan Li Multiple Sequence
Multiple Sequence Alignment by Iterative TreeNeighbor Alignments SusanMultiple Sequence Alignment by Iterative TreeNeighbor Alignments Susan
Optimisation of Multiple Sequence Alignments for Bacterial IdentificationOptimisation of Multiple Sequence Alignments for Bacterial Identification
Multiple Sequence Alignments The Global Alignment problem AGTGCCCTGGAACCCTGACGGTGGGTCACAAAACTTCTGGAMultiple Sequence Alignments The Global Alignment problem AGTGCCCTGGAACCCTGACGGTGGGTCACAAAACTTCTGGA
Multiple Sequence Alignments Profiles and Progressive Alignment ProfilesMultiple Sequence Alignments Profiles and Progressive Alignment Profiles