General Workflow Illumina Workflow Outcomes Workflow Illumina Input

General Workflow (Illumina)

Workflow Outcomes

Workflow (Illumina) Input sequence is cleaved in reads of 100 -150 bp, ligated to generic adaptors and annealed to a slide using the adaptors. These nucleotides are fluorescently labeled, with the color corresponding to the base. They also have a terminator, so that only one base is added at a time.

Workflow (Illumina) • • An image is taken of the slide. In each read location, there will be a fluorescent signal indicating the base that has been added. The terminators are removed, allowing the next base to be added, and the fluorescent signal is removed, preventing the signal from contaminating the next image

Data output • • Different technologies, though essentially similar Differences in number, length and quality of the sequences and in format of output Making data handling across platforms and analysis a challenge

Sequencing Workflow 6

Step 4 a. Data Analysis

Step 4 b. Read mapping • Align your sequences onto a reference genome or other region (unless you are de novo sequencing a new species) • Determine the coordinates and annotations if known GAAACACAAAGTG GTCTAGGGAAGAAGG ATCTTGTAGG . . TAGTACCCCATCTTGTAGGTCTGAAACACAAAGTGTGGGGTGTCTAGGGAAGAAGGTGTGTGACCAGGGAGGTCCC. . Genome

Sequence Coverage • • • Deep coverage = more accurate results Deep coverage => detecting variants Deep coverage = more expensive!

It’s all about the alignment Meyerson et al. Nature Reviews Genetics 11, 685 -696 (October 2010)

NGS pipeline Sequence Alignment/Map Binary Alignment/Map Variant Call Format from Dolled-Filhart et al, 2013