Gene n n Segment of DNA that codes

RNA n Three key differences n n Single Strand (not double stranded) Ribose Sugar

One Gene – One Enzyme n n The Beadle and Tatum experiment showed that

Transcription n n In Nucleus RNA Polymerase reads DNA Adds RNA Nucleotides to 3’

Do Now n Label the Transcription diagram

Translation n n Production of proteins from m. RNA goes to the ribosomes in

Protein Structure http: //www 3. interscience. wiley. com: 8100/legacy/college/boyer/0471661791/structure/Hb. Mb/hbmb. htm

Steps to Translation n n 1. m. RNA leaves the nucleus and binds to

Ribosome n n n Two subunits to the ribosome 3 grooves on the ribosome

Steps to Translation (Cont. ) n 3. Ribosome looks for the start Codon (AUG)

Steps to Translation (Cont. ) n n 4. Amino acids attached to a t.

Think-Pair-Share n The m. RNA sequence reads the following codons: What amino acids do

Steps to Translation (Cont. ) n n 6. t. RNA binds to the m.

Steps to Translation (Cont. ) n n 9. The m. RNA sequence continues until

Do Now Do transcription on this DNA sequence: TTTTATACTGAGGGTTAACTCGT n Do Translation- Remember to

Do Now n n n Take the following amino acid sequence, do reverse transcription

Think-Pair-Share n Get with a partner, one partner transcribes and the other translates.

Slides: 26

Download presentation

Gene n n Segment of DNA that codes for a protein DNA codes for RNA and RNA makes protein

RNA n Three key differences n n Single Strand (not double stranded) Ribose Sugar (not deoxyribose) Uracil (not thymine) Three main types n n n m. RNA t. RNA r. RNA

One Gene – One Enzyme n n The Beadle and Tatum experiment showed that one gene codes for one enzyme. One gene codes for one polypeptide - a chain of covalently bonded amino acids. (proteins are made of one or more polypeptide)

Transcription n n In Nucleus RNA Polymerase reads DNA Adds RNA Nucleotides to 3’ end m. RNA is created Carries message to ribosomes in cytoplasm

Transcribe this DNA to m. RNA

Do Now n Label the Transcription diagram

Translation n n Production of proteins from m. RNA goes to the ribosomes in the cytoplasm or the RER and produces…

PROTEINS!

Protein Structure http: //www 3. interscience. wiley. com: 8100/legacy/college/boyer/0471661791/structure/Hb. Mb/hbmb. htm

Steps to Translation n n 1. m. RNA leaves the nucleus and binds to a ribosome 2. the 5’ end of m. RNA binds to ribosome

Ribosome n n n Two subunits to the ribosome 3 grooves on the ribosome (A, P, E) A: t. RNA binding site P: polypeptite bonding site E: exit site

Steps to Translation (Cont. ) n 3. Ribosome looks for the start Codon (AUG) n Codon: group of 3 nucleotides on the messenger RNA that specifies one amino acid (64 different codons)

Steps to Translation (Cont. ) n n 4. Amino acids attached to a t. RNA molecule and are brought over to the m. RNA. 5. This t. RNA has an anticodon that matches the codon on the m. RNA strand Anticodon: Group of 3 unpaired nucleotides on a t. RNA strand. (binds to m. RNA codon)

t. RNA

Think-Pair-Share n The m. RNA sequence reads the following codons: What amino acids do they stand for? n n AUG GGA GAG CAA ** What amino acid does the anticodon CGU stand for? ***

Steps to Translation (Cont. ) n n 6. t. RNA binds to the m. RNA sequence and adds an amino acid 8. t. RNA leaves and amino acids bond together through a polypeptide bond

Steps to Translation (Cont. ) n n 9. The m. RNA sequence continues until a stop codon is reached. 10. The amino acids disconnect from the m. RNA sequence and a protein is formed.

Do Now Do transcription on this DNA sequence: TTTTATACTGAGGGTTAACTCGT n Do Translation- Remember to start the right place!

Do Now n n n Take the following amino acid sequence, do reverse transcription and translation (find RNA and DNA). Methionine, Arginine, Alanine, Serine, Tryptophan, Tyrosine, Leucine, Valine, stop What do you notice about your DNA sequences?

Think-Pair-Share n Get with a partner, one partner transcribes and the other translates.