Fig 4 19 Fig 4 20 a Molecular
- Slides: 133
Fig. 4. 19 Fig. 4. 20 a Molecular Mapping Markers
Fig. 4. 20 b
p. 143. Fluorescent dyes are often used to label DNA so that the positions of DAN fragments in a gel can be identified.
Genetics… …in the News
Chromosomal Mutations • Chromosome mutations are variations from the wild-type condition in. . . – chromosome number, – chromosome structure,
Karyotypes (viewing chromosomes) …the chromosome complement of a cell or individual, . . refers to the arrangement of metaphase chromosomes according to length,
Human Karyotypes Female Male
p Physical Maps (Cytological Maps) • AT versus GC rich regions stain differently, – i. e. Giesma stain, 1 – in a very reproducible fashion. • Short arm “petit” (p), long arm (q), • #s refer to regions, with differential staining. 2 3 q
Chromosomal Mutations – chromosome number, – structure,
Aneuploidy. . . the gain or loss of a single chromosome, – monosomy: the loss of a single chromosome, – trisomy: the gain of a single chromosome.
Meiotic Nondisjunction. . . variation in chromosome number is caused by the failure of paired homologs to segregate properly during meiosis.
Normal Disjunction 2 n = 2 first division second division haploid gamete (gametes) Disomic
2 n = 2 Nondisjunction First Division first division second division haploid gamete (gametes) Trisomic Monosomic
Nondisjunction 2 n = 2 Second Division first division second division haploid gamete (gametes) Disomic Trisomic Monosomic
Monosomy, 2 n - 1 2 n = 45, 46 -5 The loss of a single chromosome in an otherwise diploid cell.
Autosomal Monosomy • nearly always deleterious, usually lethal, – recessive lethal alleles are expressed, C a B C A B c D d E E diploid monosomic C c c Aa BB Cc Dd CC Cc EE Cc cc recessive lethal alleles
Trisomy, 2 n + 1 2 n = 46 47, +3 The gain of a single chromosome in an otherwise diploid cell.
Autosomal Trisomy • generally deleterious, – usually changes the phenotype of the individual, A B C a B c D d d E E E trisomic
Jimsonweed (Datura stramonium) Trisomy in plants
Tomato
Down Syndrome (47, +21) Trisomy in Humans
Down Syndrome (47, +21) • occurs at a frequency of about 0. 15%, • mental retardation (I. Q. 20 - 50), • mean life expectancy is about 17 years, • 47, +21 females are fertile, • trisomy 21 risk factors, maternal age.
Down Syndrome Trisomy in Humans
Down Syndrome Critical Genes • Chromosome 21 has about + 351 genes, – natural feedback mechanisms limit dosage effects of most of these genes, • It is estimated that the improper expression of approximately 20 -40 genes produces the variety of phenotypes.
Maternal Age and Down Syndrome
Maternal Age? • in female humans, oocytes arrest in Prophase I before birth, – meiosis continues upon menstruation, – thus, tetrad formation and cellular function must be maintained for decades. • and, as mother’s age increases, maternal detection of trisomy may be attenuated and spontaneous abortions drops.
Other Human Autosomal Trisomics • Edwards Syndrome (47, +18) – – 0. 0125% live births, mental abnormalities, “faunlike ears”, “rockerbottom feet”, small jaw, nearly all die within several weeks of birth, • Patau Syndrome (47, +13), – – 0. 005% live births, mental abnormalities, cleft lip, small mal-formed head, “rockerbottom feet”, mean life expectancy is about 130 days.
Autosomal Trisomy Causation • Age of Parents, • Random Errors, – or genetic predisposition, • Especially malfunction of recombination machinery, – crossing over and subsequent recombination are necessary for proper chromosome disjunction.
Sex Chromosome Monosomy • Turner Syndrome (45, X), – sometimes referred to as XO,
Turner Syndrome (45, X) - 0. 03% live female births, - infertile, - normal intelligence, although specific cognitive functions may be affected.
Sex Chromosome Trisomy • Klinefelter Syndrome (47, XXY),
Klinefelter Syndrome (47, XXY) - 0. 1% - 0. 2% live male births, - infertile, - mildly retarded. 48, XXXY; 48, XXYY; 49, XXXXY; 49, XXXYY
XXX Syndrome (47, XXX) • 47, XXX Syndrome, – 0. 08 % female births, – typically normal development, – fertile.
XYY Syndrome (47, XYY) • 47, XYY Syndrome, – 0. 10 % male births, – above average height, – sub-normal intelligence, – fertile. Genetic Disposition for Antisocial and Criminal Behavior? No.
1, 000 Conceptions 850, 000 Live Births 150, 000 Spontaneous Abortions 5165 Chromosomal Abnormalities 1849 (about 2: 1 males) Sex Chromosome Aneuploid 1183 (20: 2: 1) Autosomal Trisomics
1, 000 Conceptions 850, 000 Live Births 150, 000 Spontaneous Abortions 75, 000 Chromosome Mutations 39, 000; Trisomics 13, 500; XO
Aneuploidy Summary • Autosomal Monosomy, – nearly always deleterious, • Autosomal Trisomy, – usually deleterious, – trisomic individuals usually show distinct phenotypes, • Sex Chromosome Aneuploidy, – results in Turner or Klinefelter Syndromes, – 47, XXX, often normal, – 47, XYY, mild retardation, tall.
Chapter 5 • Do all of the practice questions (except 20).
Chromosomal Mutations • Chromosome mutations are variations from the wild-type condition in. . . – chromosome number, – chromosome structure,
Polyploidy …more than two haploid sets of chromosomes are present, – 2 n = diploid, – 3 n = triploid, – 4 n = tetraploid, – etc.
Polyploidy Generalities de novo • rare in most animal species, • known in lizards, fish and amphibians, • fairly common in plants, • odd numbers of ploidy are not usually maintained, – 3 n, 5 n, etc. • rarely found in organisms that rely on sexual propagation.
Autopolyploidy. . . polyploidy resulting from the replication of one or more sets of chromosomes, …the additional set of chromosomes is identical to the normal haploid complement of that species.
added 1 x 2 x
Autopolyploidy …can be induced by treating cells with the drug colchicine, â colchicine: is a alkaloid derivative from the autumn crocus (Crocus veneris), . . . inhibits microtubule polymerization, and thus inhibits the separation of chromosomes during meiosis. Crocus veneris …autumn crocus, …meadow saffron, …naked ladies.
Colchicine Treatment • 2 n cells undergo S-phase, • no separation of chromosomes is accomplished, • no cell division occurs, • at telophase, the nuclear membrane reforms, • treatment for one cell cycle leads to 4 n cells.
Natural Autopolyploidy • Heat, cold also affect microtubule polymerization and can lead to autopolyploidy.
Allopolyploidy …formed by the union of two or more distinct chromosome sets, . . . i. e. , from different species.
The Sad Tail of Raphanobrassica …Vegetable of the Proletariet? Cast Dr. G. Karpechenko, Russian Plant breeder, Brassica oleracea (2 n = 18), - cabbage, large above ground food stock, ~value-less root, Raphanus sativus (2 n = 18), - the common radish, large root food stock, ~value-less leaves.
Super Vegetable? Cabbage 2 n 1 = 18 n 1 = 9 Radish 2 n 2 = 18 n 2 = 9 x n 1 + n 2 = 18 sterile spontaneous autopolyploidy 2 n 1 + 2 n 2 = 36
Amphidiploid …double diploid, 2 n 1 + 2 n 2 …have balanced gametes of the type n 1 + n 2, these gametes fuse to make fertile 2 n 1 + 2 n 2.
Raphanobrassica? • Roots of cabbage, leaves of radish, – dud-vegetable for Karpechenko, abandoned the project. • Revived by the Scottish Plant Breeding Station in Dundee, Scotland, – Raphanobrassica’s high dry matter content makes it an excellent fodder for sheep and cattle.
Allopolyploidy in Plants Wheat Cotton Apples Plums Strawberries Longanberries Tobacco Potatoes more. . .
Autopolyploidy Applications • Treating a parent plant with colchicine often produces autopolyploidy, resulting in offsprings with larger flowers and/or fruit, 4 n 2 n 8 n 2 n
Allopolyploidy Applications B. oleracea (cabbage, cauliflower, Brocolli, kale, etc. ) 2 n = 18 n=9 B. n 1 napas + n 2 =( 19 Oil rape, canola oil) 2 n 1 + 2 n 2 = 38 n = 10 B. campestris (turnip, turnip rape) 2 n = 20 amphidiploid
4 n x 2 n = 3 n? • The creation of triploids can be accomplished by crossing a tetraploid with a diploid, • Most triploid individuals are sterile.
Generation of a Triploid Cells
Meiosis in a Triploid Organism
Who’d want to Eat That? • Bananas, • Seedless Watermelon, • Most other seedless varieties, • Some oysters.
Environmental Applications? grass carp (Ctenopharyngodon idella) • grass carp prefer pondweeds, • do not prefer plants such as cattail, water lily, etc. Ø Triploid grass carp do not reproduce…
Polyploidy Summary • More than 2 whole sets of chromosomes, • Autopolyploidy, – from the same genome, – naturally occurring, or induced, – often results in larger varieties, • Allopolyploidy, – from different genomes, – naturally occurring, or induced, – often results in larger varieties, • Autotriploids, – most often sterile – can produce beneficial traits.
Monoploidy …a haploid of a diploid is monoploid, …has one chromosome set.
Monoploid • male wasps, bees and ants have only 1 haploid genome, – males develop from unfertilized eggs, • gametes are formed by mitosis. Bees (example)
Monoploid Applications • monoploid plants can be created by culturing pollen grains (n = 1), – the population of haploid organisms is then screened for favorable traits, – the plants are then treated with colchicine which generates a 2 n plant homozygous for the favorable trait(s).
Chromosomal Mutations – chromosome number, – structure,
Chromosome Structure • Changes in chromosome structure can come about due to, deletions duplications rearrangements
Chromosomal Deletions …a deletion results in a lost portion of a chromosome, – deletion causative agents, • heat, • radiation, • viruses, • chemicals, • errors in recombination.
Terminal Deletions Off the End
Intercalary Deletions From the Middle
Recognizing Deletions Terminal Intercalary
Homologous Pairs? Intercalary Hemizygous Terminal Hemizygous: gene is present in a single dose. Psuedodominance: hemizygous genes are expressed.
Deletions …result in partial monosomy, Ø remember monosomy: 2 n, -1, …the organism is monosomic for the portion of the chromosome that is deleted, …as in monosomy, most segmental deletions are deleterious.
Cri-du-chat Syndrome (46, -5 p)
46, -5 p. . . terminal deletion of the small arm (petite arm) of chromosome 5, • Cri-du-chat Syndrome, – – 0. 002% live births, anatomic mutations, often mental retardation, abnormal formation of vocal mechanisms.
Chromosome Structure • Changes in chromosome structure can come about due to, deletions duplications rearrangements
Chromosomal Duplication. . . an event that results in the increase in the number of copies of a particular chromosomal region,
Duplication Cause and Effect Causes: – duplications often result from unequal crossing over, – can occur via errors in replication during S-Phase. Effects: – results in gene redundancy, – produces phenotypic variation, – may provide an important source for genetic variability during evolution.
Unequal Crossing Over Produces both duplications and deletions!
Duplication Phenotypes
Duplication in Evolution …essential genes do not tolerate mutation, …duplications of essential genes, followed by mutations, confers adaptive potential to the organism, …new gene family members are ‘recruited’ to perform new functions.
flowering plant algae moss nutrients need uptake transport to other tissue transport to seeds
Arabidopsis
Chromosome Structure • Changes in chromosome structure can come about due to, deletions duplications rearrangements
Chromosomal Inversions …inversion: aberration in which a portion of the chromosome is turned around 180 o.
Paracentric Inversion. . . an inversion in which the centomere is not included, A B C A B B A C . . . a paracentric inversion does not change arm length ratio.
Inversion Heterozygotes …an organism with one wild-type and one chromosome containing an inversion, A B C B A C …not heterozygous for the genes, heterozygous for the chromosomes.
Inversion Loop no crossing over gametes
Paracentric Produces haploid gamete.
Paracentric Produces gamete with inversion.
Paracentric Produces a chromosome with two centromeres. Nonviable gametes.
Dicentric. . . a chromosome having two centromeres;
Non-Viable (gametes) Segregate
Dicentric/Ascentric …results only when the crossing over occurs within the region of the paracentric inversion,
Paracentric No centromeres. Deletions. Nonviable gametes.
Acentric …a chromosome having no centromeres, …segregates to daughter cells randomly, or is lost during cell division, …deletions impartial monosomy.
Paracentric Outcomes 1 Normal Gamete, 1 Inversion Gamete, No Crossover Classes Recombination is not inhibited, but recombinant gametes are selected against.
Plant Biotechnology Information later in the Quarter
Pericentric Inversion. . . an inversion in which the centromere is included, A B C A C B . . . a pericentric inversion results in a change in chromosome arm length.
Pericentric
Recombination and Inversions • Paracentric and Pericentric; – 1 Normal Gamete, – 1 Inverted Gamete, – (No) Crossover Classes = No Recombination… …in area of inversion. Inversions select against recombinant gametes, thus preserves co-segregation of specific alleles.
Inversions and Evolution • Inversions ‘lock’ specific alleles together, – all offspring get their alleles from either a wildtype, or inverted chromosome, • If the ‘set of alleles’ is advantageous, the set can be maintained in the population.
Assignment • Know how inversions alter the outcomes of recombination, • Understand the differences between ‘Interference’, and the suppression of recombination resulting from inversions, • Be able to recognize data, and predict results given either case.
Chapter 5 • Do all of the practice questions (except 20).
Chromosome Structure • Changes in chromosome structure can come about due to, deletions duplications rearrangements
Translocations …translocation: aberration associated with the transfer of a chromosomal segment to a new location in the genome.
Terminal Translocation
Reciprocal Translocation
Translocation and Semi-Sterility …semi-sterility; a condition in which a proportion of all gametophytes (in plants) or zygotes (in animals) are inviable. • Up to 50% are inviable as a result of translocations.
Robertsonian Translocations …the fusion of long arms of acrocentric chromosomes,
Down Syndrome • 95% of Down Syndrome individuals are a result of Trisomy 21, – the probability of having a second Down Syndrome child is usually similar to the population at large, • However, there is second cause of Down Syndrome caused by a Robertsonian translocations that is heritable.
Familial Down Syndrome
Assignment • Do a Punnett Square or a Split Fork Diagram of, Parent 1: wild-type for Chromosomes 14, 21 x Parent 2: heterozygous for 14 q; 21 q translocation.
Hint gametes
Assignment (think about these. . . ) • Truncated Genes; – genes that are no longer full length, due to a mutation, • Gene Fusions; – genes that contain coding sequence from two different genes, resulting from a chromosomal mutation.
Trinucleotide Repeat Expansions FMR 1 Fragile X Mental Retardation 1. . . GCGCGGCGGTGACGGAGGCGCCGC TGCCAGGGGGCGTGCGGCAGCG. . . cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg …CTGGGCCTCGAAGCGCCCGCAGCCA cgg cgg. . . cgg cgg > 200
Fragile Site Mutations
Syntenic • Relationship of two or more loci found to be linked in one species; literally “on the same thread”. • Conserved Synteny: state in which the same two loci are found to be linked in several species.
Cereals
Conserved Synteny Description of DNA segments in which gene order is identical between species.
Chapter 5 Review • know genotypes and phenotypes, – – – – trisomy, monosomy, inversions, duplications, deletions, polyploidy, dosage compensation. • be able to predict heritability, and recognize datasets and infer the condition.
Wednesday • Reciprocal Translocations, • Mapping deletions, • Review • Work some problems.
Dosage Compensation • X chromosomes in females provide twice the genes, as in males, – Drosophila: female genes are expressed at 50% of the male levels, – Mammals: one X chromosome in females is silenced.
Canadian Cat Scientist Sees it First Barr Body
Lyon Hypothesis Mary Lyon; in humans, X chromosomes from father and mother are randomly inactivated.
X Inactivation Barr Body The structure of the chromosome is altered.
X-Linked Mosaicism Different cell lineages contribute to different body locations on the body.
- Fig. 2
- Covalent bond melting point
- Ionic covalent metallic
- Zinc oxide + nitric acid → zinc nitrate + water
- Sig fig rules
- Baluarte de la verdad
- Two significant figures
- Fig 29
- Sig fig rules
- Average temperature in the rainforest
- Sig fig def
- Fig
- Fig 54
- Significant figures conversion
- Dorsal hollow nerve cord
- Pros and cons of cochlear implants quizlet
- Symbols in the bell jar
- Old world monkeys
- Sig figs addition
- Properties of indifference curve
- Sig fig rules
- Fig 19
- Sig fig
- An aluminum shaft with a constant diameter of 50mm
- Why did jesus cursed the fig tree
- Sig figs
- Body directions and planes
- Life cycle of cladophora
- Fig 16
- 52
- Sig figs for logs
- "city lights on fig"
- Significant figure game
- Http:/image of fig. 1
- Significant figures
- Fig. 5
- Unikonta
- Logarithm significant figures
- Sig fig ca
- Sig fig checker
- 2 significant figures
- Parable of the barren fig tree
- Msh
- Fig tree
- Gradient de concentration
- Significant figures for ph
- What are significant figures in chemistry
- Fig 42
- Fig president
- How many sig figs on a thermometer
- Nonzero digits
- Log a x log a
- Fig 19
- Fig wasp
- Servings per container 30
- Sig fig prefixes
- Fig organisasi
- Rounding off rules for 5
- "first fig marketing"
- End times wood
- Fig 1
- Fig 1003
- Sig fig tutorial
- The number of significant figures in 3400 is
- Fungi
- Molecular friction
- Sodium nitrate and silver nitrate
- Postulates of kinetic theory of gas
- Kinetic molecular theory timeline
- Dihydrogen monosulfide shape
- What is an unshared pair of electrons
- How to get empirical formula from percentages
- Chem 150
- Plant viruses
- Galena formula
- Geometria do oxigenio
- Molecular shapes
- Heteronuclear molecular orbital diagram
- Bond angles chart
- Idocaína
- Molecular cell biology lecture
- Bio molecular systems ltd
- Neutral mutation
- Valence bond theory shapes
- Cell and molecular biology lectures
- Molecular gastronomy history
- Carbohydrate formula
- Hcl molecular geometry
- Number-average molecular weight
- Nomenclature
- Tromboprofilaxis en fractura de cadera
- Empirical formula rounding rules
- Kinetic molecular theory of gases
- Chemical formulas quiz
- Hno hybridization
- Stoichiometric air fuel ratio
- Empirical formula from percentages
- Masa molecular uma
- Democritus atomic model diagram
- Potassium formula mass
- Chlorine covalent bond
- Chapter 4 carbon and the molecular diversity of life
- Pqqp dad
- Nfh2 molecular geometry
- Stoichiometry mole-mole
- Trends in molecular medicine
- Molecular technology
- Empirical and molecular formula
- Restriction enzymes
- Molecular mass
- Fuerza molecular
- Molecular ecological network analyses
- Giunzione di holliday
- Sigma orbital and pi orbital
- Iodometric titration
- Molecular biology crash course
- Kinetic molecular theory
- Molecular farming definition
- Grupo funcional nitrogenado
- Kinetic molecular theory of liquids and solids
- Covalent molecular and covalent network
- Clasificacion de las proteinas
- Phaser molecular replacement
- Bfcl2 molecular shape
- Lewis structure of pf3
- Gradualismo
- Lesson 81 drop in molecular views answer key
- Nct quimica
- Formation of molecular orbitals
- Select the most polar bond amongst the following
- Molecular replacement method
- What is the general formula for alkenes?
- "molecula"
- Dogma central de la biología molecular