Epidemiology of Rabies in Southeast Europe Nicholas Johnson

Epidemiology of Rabies in Southeast Europe Nicholas Johnson Rabies and Wildlife Zoonoses Group WHO Collaborating Centre for the Characterization of Rabies and Rabies-Related Viruses 1

Introduction Ø Rabies is endemic within many countries of south east Europe Ø The fox is the principal reservoir species but dog rabies cases still reported Ø Few epidemiological studies reported from the region Ø Identify factors that contribute to epidemiology Ø Lack of knowledge hampers vaccination programmes 2

Southeast Europe (the Balkans) 3

The Balkan Peninsular Poland Russia Czech Republic Slovakia Austria Ukraine Hungary Slovenia Croatia Bosnia and Herzegovina Albania Romania Serbia Bulgaria Mac Greece Turkey 4

Cohort Details Country (Cases 2005) Fox Dog Bosnia-Herzegovina (36) 10 3 Bulgaria (8) 5 2 Jackal 2 Georgia 1 Other Not recorded 2 Hungary (9) 3 Poland (138) 2 Romania (530) 3 2 Russia (3087) 3 1 17 2 12 1 1 5 2 1 9 1 1 Slovak Republic (50) 7 [Total] 4 1 Serbia & Montenegro (101) Turkey (193) Human 4 2 9 5 1 1 1 21 75 5

Isolate details Code No. Country Region Species Year Genbank Accession Number 5 Bulgaria Lovech Fox 2003 DQ 300293 1279 Romania Iolomita Fox ? - RV 1124 Turkey Manisa Fox 2000 AY 091610 6

Region of the Genome N P M G L 327 nucleotides TTATCGTGGATCAATATGAGTACAAGTACCCTGCCATCAAAGATTTGAAAAAGCCCTGTATAACTCTAGGAAAGGCTCCC GATTTAAAGCATACAAGTCAGTTTTATCATGAGCGCCGCCAAACTTGATCCTGACGATGTTCCTATTT GGCGGCGGCAATGCAGTTTTTTGAGGGGACATGTCCGGAAGACTGGACCAGCTATGGAATCGTGATTGCACGAAAAGGAG ATAAGATCACCCCAGGTTCTCTGGTGGAGATAAAACGTACTGATGTAGAAGGGAATTGGGCTCTGACAGGAGGCATGGAA CTGACAAGAGACCCCAC 7

Phylogenetic analysis of RABV sequences from Southeastern Europe Bulgaria SAD B 19 Eastern Turkey Pasteur Romania Western Turkey Romania / Russia Bosnia-Herzegovina 8

Phylogenetic tree of Eastern European Isolates * * * Bosnia-Herzegovina * * * 0. 01 substitutions / site Bootstrap values > 700 Outgroup * * Eastern Romania / Russia ** * Central Romania Bulgaria * Wave 1: Western Turkey 9

Romania / Russia Romania / Poland 10

Bulgaria Targovishte Dobrich Lovech Montana Pleven Lovech Former Yugoslavia Vidin Montana 11

Bosnia-Herzegovina Bosnia. Herzegovina Hungary 12

Conclusions Ø Most isolates fall into the East European group of viruses Ø Geography dominates isolate clustering Ø Topography may play a significant role in preventing spread of fox-rabies Ø The Danube appears to block movement between Romania and Bulgaria Ø Such factors could assist in future vaccination campaigns 13

Acknowledgements Co-Authors Veterinary Laboratories Agency (UK) FLI-Wusterhausen (Germany) IDT (Germany) Etlik CVRI (Turkey) Natl. Diag. & Res Vet Inst (Bulgaria) Inst. Diag. & Animal Health (Romania) Univ. Sarajevo (Bosnia-Hervegovina) Vet. Inst. Of Republika of Srpska Funding Defra (UK) AR Fooks T Muller, C Freuling A Vos O Aylan H Un R Valtchovski M Turcitu F Dumistrescu V Vlad R Velic V Sandrac 14