Dot Plot Dot Plot Goal We will take
- Slides: 25
Dot Plot
Dot Plot
Goal • We will take two nucleotide base strings and look for common patterns – stretches where the bases match. • GAATTCATACCAGATCACCGAAAACTGTCCTCCA AATGTGTCCCCCTCACACTCCCAAAT • TCGCGGGCTTCTGCTCTTAGACCACTCTACCCTA TTCCCCACACTCACCGGAGCCAAAGC
Start by entering the two sequences in question in Excel
Use the LEN Function to determine the length of the string
Set up a grid – mine was 60 -by-60 since the lengths were 60
Enter the length of match one is seeking – start with 1
Enter the formula to look for matches
Anatomy of the formula (Part 1) • =IF(MID($B$1, E$3, $B$4)=MID($B$2, $D 4, $B$4), 1, 0) • Recall MID takes a string $B$1 is the first base sequence and $B$2 is the second base sequence • Then MID takes a part of the string beginning at the “second argument”
Anatomy of the formula (Part 2) • =IF(MID($B$1, E$3, $B$4)=MID($B$2, $D 4, $B$4), 1, 0) • The starting point varies. • E$3 stays in the third row as the formula is copied and uses the various numbers 1 through 60 set up in row 3. • $D 4 stays in column D and uses the various numbers 1 through 60 set up in column D.
Anatomy of the formula (Part 3) • The third argument is the length of the match we seek. They are both the same length. • If the two “substrings” (base mini sequences) match, output a 1, otherwise a zero. • Then copy the formula throughout the grid.
With formula copied
Next add some conditional formatting rules
Result of Conditional Formatting
We are we looking for? • In dot plots, one looks for dots (for us colored cells) along diagonals. • A “long” diagonal means that the mini base sequences within the longer sequence match.
Change the length to eliminate some of the “noise”
Increasing the length of the substring match
Question • What is the longest match between these two sequences?
Problem • We are looking for diagonal matches; however, increasing the length of the match only allows only one of the two diagonal types to survive.
New Sheet: Enter one string and also make column of descending numbers
Enter formula that takes one letter at designated position
Use the concatenate formula to create the reversed string
Use Copy/Paste Special/Values to enter reversed string
Repeat the analysis looking for matches between one original and one reversed string
Question • What is the longest match between these: one of the original sequences and one of the reversed sequences?
- 192 dot 168 dot 1 dot 1
- Take a bus or take a train
- 1-5 solving inequalities
- Java vs dot net
- Dot plot vs stem and leaf
- Dot plot advantages
- Definition of dot plot
- Box plot vocabulary
- The double box plot shows the test scores
- Dot plot
- Dot
- Teacher twins@2015
- Mean median mode jeopardy
- Dot plot minitab
- Uniform dot plot
- Dot plot betekenis
- What is a uniform distribution dot plot
- Dna dot plot
- Dot plot
- Dot plot bioinformatics example
- Matrici pam
- What is a cluster on a dot plot
- Plot diagram
- Merchant of venice resolution
- Exposition examples
- The merchant of venice plot