Dot Plot Dot Plot Goal We will take

  • Slides: 25
Download presentation
Dot Plot

Dot Plot

Dot Plot

Dot Plot

Goal • We will take two nucleotide base strings and look for common patterns

Goal • We will take two nucleotide base strings and look for common patterns – stretches where the bases match. • GAATTCATACCAGATCACCGAAAACTGTCCTCCA AATGTGTCCCCCTCACACTCCCAAAT • TCGCGGGCTTCTGCTCTTAGACCACTCTACCCTA TTCCCCACACTCACCGGAGCCAAAGC

Start by entering the two sequences in question in Excel

Start by entering the two sequences in question in Excel

Use the LEN Function to determine the length of the string

Use the LEN Function to determine the length of the string

Set up a grid – mine was 60 -by-60 since the lengths were 60

Set up a grid – mine was 60 -by-60 since the lengths were 60

Enter the length of match one is seeking – start with 1

Enter the length of match one is seeking – start with 1

Enter the formula to look for matches

Enter the formula to look for matches

Anatomy of the formula (Part 1) • =IF(MID($B$1, E$3, $B$4)=MID($B$2, $D 4, $B$4), 1,

Anatomy of the formula (Part 1) • =IF(MID($B$1, E$3, $B$4)=MID($B$2, $D 4, $B$4), 1, 0) • Recall MID takes a string $B$1 is the first base sequence and $B$2 is the second base sequence • Then MID takes a part of the string beginning at the “second argument”

Anatomy of the formula (Part 2) • =IF(MID($B$1, E$3, $B$4)=MID($B$2, $D 4, $B$4), 1,

Anatomy of the formula (Part 2) • =IF(MID($B$1, E$3, $B$4)=MID($B$2, $D 4, $B$4), 1, 0) • The starting point varies. • E$3 stays in the third row as the formula is copied and uses the various numbers 1 through 60 set up in row 3. • $D 4 stays in column D and uses the various numbers 1 through 60 set up in column D.

Anatomy of the formula (Part 3) • The third argument is the length of

Anatomy of the formula (Part 3) • The third argument is the length of the match we seek. They are both the same length. • If the two “substrings” (base mini sequences) match, output a 1, otherwise a zero. • Then copy the formula throughout the grid.

With formula copied

With formula copied

Next add some conditional formatting rules

Next add some conditional formatting rules

Result of Conditional Formatting

Result of Conditional Formatting

We are we looking for? • In dot plots, one looks for dots (for

We are we looking for? • In dot plots, one looks for dots (for us colored cells) along diagonals. • A “long” diagonal means that the mini base sequences within the longer sequence match.

Change the length to eliminate some of the “noise”

Change the length to eliminate some of the “noise”

Increasing the length of the substring match

Increasing the length of the substring match

Question • What is the longest match between these two sequences?

Question • What is the longest match between these two sequences?

Problem • We are looking for diagonal matches; however, increasing the length of the

Problem • We are looking for diagonal matches; however, increasing the length of the match only allows only one of the two diagonal types to survive.

New Sheet: Enter one string and also make column of descending numbers

New Sheet: Enter one string and also make column of descending numbers

Enter formula that takes one letter at designated position

Enter formula that takes one letter at designated position

Use the concatenate formula to create the reversed string

Use the concatenate formula to create the reversed string

Use Copy/Paste Special/Values to enter reversed string

Use Copy/Paste Special/Values to enter reversed string

Repeat the analysis looking for matches between one original and one reversed string

Repeat the analysis looking for matches between one original and one reversed string

Question • What is the longest match between these: one of the original sequences

Question • What is the longest match between these: one of the original sequences and one of the reversed sequences?