DNAMethylation and Restriction of DNA Internship Epigenetics Definitions

  • Slides: 16
Download presentation
DNA-Methylation and Restriction of λ-DNA Internship Epigenetics

DNA-Methylation and Restriction of λ-DNA Internship Epigenetics

Definitions Cla. I restriction enzyme Dam methylase Dam Co factor SAM M SA Cp.

Definitions Cla. I restriction enzyme Dam methylase Dam Co factor SAM M SA Cp. G methylase Cp. G Mbo. I restriction enzyme

Methylation of λ-DNA with Dam Enzyme: Dam methylase Co factor SAM M SA Dam

Methylation of λ-DNA with Dam Enzyme: Dam methylase Co factor SAM M SA Dam methyl group 5‘ … ACAGATCACAGATGACGAT … 3‘ Sequence for Dam to recognize Sequence for Cp. G to recognize

Methylation of λ-DNA with Dam M SA 5‘ … ACAGATCACAGATGACGAT … 3‘ Sequence for

Methylation of λ-DNA with Dam M SA 5‘ … ACAGATCACAGATGACGAT … 3‘ Sequence for Dam to recognize Sequence for Cp. G to recognize

Methylation of λ-DNA with Dam 5‘ … ACAGATCACAGATGACGAT … 3‘ Sequence for Dam to

Methylation of λ-DNA with Dam 5‘ … ACAGATCACAGATGACGAT … 3‘ Sequence for Dam to recognize Sequence for Cp. G to recognize

Methylation of λ-DNA with Cp. G Enzyme: Cp. G methylase Co factor: SAM M

Methylation of λ-DNA with Cp. G Enzyme: Cp. G methylase Co factor: SAM M SA Cp. G methyl group 5‘ … ACAGATCACAGATGACGAT … 3‘ Sequence for Dam to recognize Sequence for Cp. G to recognize

Methylation of λ-DNA with Cp. G M SA Cp. G 5‘ … ACAGATCACAGATGACGAT …

Methylation of λ-DNA with Cp. G M SA Cp. G 5‘ … ACAGATCACAGATGACGAT … 3‘ Sequence for Dam to recognize Sequence for Cp. G to recognize

Methylation of λ-DNA with Cp. G 5‘ … ACAGATCACAGATGACGAT … 3‘ Sequence for Dam

Methylation of λ-DNA with Cp. G 5‘ … ACAGATCACAGATGACGAT … 3‘ Sequence for Dam to recognize Sequence for Cp. G to recognize

Restriction of Dam-methylated and non-methylated λ-DNA with Mbo. I Dam-methylated Restriction enzyme Mbo. I

Restriction of Dam-methylated and non-methylated λ-DNA with Mbo. I Dam-methylated Restriction enzyme Mbo. I Methyl group from Dam Non-methylated Restriction enzyme Mbo. I 5‘ … ACAGATCACAGATGACGAT … 3‘ 5‘ … ACA GATCACAGATGACGAT … 3‘ Sequence for Mbo. I to recognize and cut

Restriction of Cp. G-methylated and non-methylated λ-DNA with Cla. I Cp. G-methylated Restriction enzyme

Restriction of Cp. G-methylated and non-methylated λ-DNA with Cla. I Cp. G-methylated Restriction enzyme Cla. I Methyl group from Cp. G 5‘ … ACAACATCGATAATGAATCAT … 3‘ Sequence for Cla. I to recognize and cut Nicht methyliert Restriktionsenzym Cla. I 5‘ … ACAACATCGATAATGAATCAT … 3‘ Sequence for Cla. I to recognize and cut

Regular Case of a Restriction Cp. G-methylated λ-DNA, cutted with Mbo. I Cp. G

Regular Case of a Restriction Cp. G-methylated λ-DNA, cutted with Mbo. I Cp. G methylated 5‘ … ACAGATCACAGATGACGAT … 3‘ Sequence for Mbo. I to recognize and cut Sequence for Cp. G to recognize : Restriction enzyme Mbo. I

Exception for a Restriction Cp. G-methylated λ-DNA, cutted with Mbo. I Cp. G methylated

Exception for a Restriction Cp. G-methylated λ-DNA, cutted with Mbo. I Cp. G methylated 5‘ … AAGATCGCAGATGACGAT … 3‘ Sequence for Mbo. I to recognize and cut Sequence for Cp. G to recognize : Restriktionsenzym Mbo. I

Regular Case of a Restriction Dam-methylated λ-DNA, cutted with Cla. I Dam methylated 5‘

Regular Case of a Restriction Dam-methylated λ-DNA, cutted with Cla. I Dam methylated 5‘ … ACGATCACAGATATCGATGAT … 3‘ Sequence for Dam to recognize Sequence for Cla. I to recognize and cut : Restriction enzyme Cla. I

Exception for a Restriction Dam-methylated λ-DNA, cutted with Cla. I Dam methylated 5‘ …

Exception for a Restriction Dam-methylated λ-DNA, cutted with Cla. I Dam methylated 5‘ … AAGATCACAGATATCGATCAT … 3‘ Sequence for Dam to recognize Sequence for Cla. I to recognize and cut : Restriction enzyme Cla. I

Proof of λ-DNA fragments cutted with Mbo. I λ-DNA = non-methylated Lambda-DNA λ-DNA Mbo.

Proof of λ-DNA fragments cutted with Mbo. I λ-DNA = non-methylated Lambda-DNA λ-DNA Mbo. I = non-methylated Lambda-DNA cutted with Mbo. I λ-DNA/Dam Mbo. I = Dam-methylated Lambda-DNA cutted with Mbo. I λ-DNA/Dam Mbo. I

Proof of λ-DNA fragments cutted with Cla. I λ-DNA = non-methylated Lambda-DNA λ-DNA Cla.

Proof of λ-DNA fragments cutted with Cla. I λ-DNA = non-methylated Lambda-DNA λ-DNA Cla. I = non-methylated Lambda-DNA cutted with Cla. I λ-DNA/Cp. G Cla. I = Cp. G-methylated Lambda-DNA cutted with Cla. I λ-DNA/Cp. G Cla. I

EPIGENETICS Epigenetics possible definitions Epigenetics comprises hereditary changesEPIGENETICS Epigenetics possible definitions Epigenetics comprises hereditary changes
Epigenetics What are epigenetics Epigenetics is the externalEpigenetics What are epigenetics Epigenetics is the external
Restriction Enzymes WHAT ARE RESTRICTION ENZYMES Restriction EnzymesRestriction Enzymes WHAT ARE RESTRICTION ENZYMES Restriction Enzymes
Restriction enzymes Restriction endonucleases Restriction enzymes Are enzymesRestriction enzymes Restriction endonucleases Restriction enzymes Are enzymes
DNA Restriction enzyme DNA ligase DNA PCR DNADNA Restriction enzyme DNA ligase DNA PCR DNA
Internship epigenetic Internship DNA methylation of DNA ObjectiveInternship epigenetic Internship DNA methylation of DNA Objective
Restriction Enzymes Restriction Enzymes Enzyme that cuts DNARestriction Enzymes Restriction Enzymes Enzyme that cuts DNA
Cutting DNA b Restriction endonucleases restriction enzymes stickyCutting DNA b Restriction endonucleases restriction enzymes sticky
Restriction Enzymes Restriction Enzymes Enzyme that cuts DNARestriction Enzymes Restriction Enzymes Enzyme that cuts DNA
Restriction Enzymes Electrophoresis 1 Cutting DNA Restriction enzymesRestriction Enzymes Electrophoresis 1 Cutting DNA Restriction enzymes
Restriction Enzymes Restriction Enzymes scan the DNA sequenceRestriction Enzymes Restriction Enzymes scan the DNA sequence
Restriction Enzymes Restriction Enzymes Enzyme that cuts DNARestriction Enzymes Restriction Enzymes Enzyme that cuts DNA
Techniques for DNA testing Restriction Enzymes RESTRICTION enzymesTechniques for DNA testing Restriction Enzymes RESTRICTION enzymes
Importance of proteomics and epigenetics Epigenetics Against CentralImportance of proteomics and epigenetics Epigenetics Against Central
What is epigenetics Mendelian and non mendelian epigeneticsWhat is epigenetics Mendelian and non mendelian epigenetics