DNA The Genetic Material Identifying the Genetic Material

DNA: The Genetic Material

Identifying the Genetic Material • Experiments of Griffith and Avery yielded results that suggested DNA was genetic material (1944)

• Hershey & Chase used the bacteriophage T 2 and radioactive labels to show that virus genes are made of DNA, not protein (1952)

• DNA stores information that tells cells which proteins to make and when to make them https: //www. youtube. com/watch? v=b. Vk 0 t w. JYL 6 Y

The Structure of DNA • Discovered by Watson & Crick in 1953 & received Nobel Prize in 1962 along with Maurice Wilkins http: //www. youtube. com/watch? v =sf 0 YXn. AFBs 8&feature=autoplay& list=PL 4900 A 106005340 D 0&lf=res ults_video&playnext=2

• • • DNA Polymer : Nucleotide Monomer Each Nucleotide has 3 parts: 1) 5 carbon sugar Deoxyribose 2) Phosphate group PO 4 3) Nitrogen Base

Nitrogen Bases Purines Adenine Guanine Pyrimidines Thymine Cytosine

A Human 30 Plant 27 Virus 21 T 30 27 22 • DNA forms a spiral ladder Double Helix • Double helix is held together by weak Hydrogen bonds • Erwin Chargaff Discovery Chargaff’s Rule A=T, G=C G 19 22 28 C 19 22 27

DNA Replication • Phase of Cell Cycle? Why replicate? • Step 1: DNA Helicase unzips DNA by breaking weak Hydrogen bonds. • Step 2: DNA polymerase adds nucleotides to exposed nitrogen bases. • Step 3: Two DNA molecules form that are identical to original.

• DNA is referred to as “Semi-conservative”, Each DNA molecule 1 template & 1 new strand • DNA polymerase proofreads DNA during its replication so that very few errors occur http: //www. youtube. com/ watch? v=zd. Dki. Rw 1 Pd. U https: //www. yout ube. com/watch? v =5 q. Srmei. Wsuc

• 500/sec bacteria • 50/sec human

Fig. 17 -4 DNA molecule Gene 2 Gene 1 Gene 3 DNA template strand TRANSCRIPTION m. RNA Codon TRANSLATION Protein Amino acid

Fig. 17 -3 a-2 • In prokaryotes, m. RNA produced by transcription is immediately translated without more processing TRANSCRIPTION DNA m. RNA Ribosome TRANSLATION Polypeptide (a) Bacterial cell

Fig. 17 -3 b-3 Nuclear envelope DNA TRANSCRIPTION Pre-m. RNA PROCESSING m. RNA TRANSLATION Ribosome Polypeptide (b) Eukaryotic cell

Transcription • http: //www. stolaf. edu/people/giannini/bi ological%20 anamations. html • Occurs in the nucleus • An RNA polymerase enzyme binds to the promoter and makes a m. RNA (messenger RNA) complementary to the DNA gene

Translation • Occurs in the cytoplasm • m. RNA carries the code from the DNA • Amino acids are assembled to synthesize proteins at ribosomes

Translation • t. RNA (transfer RNA) carries amino acids, which bind to threeletter nucleotide sequences on the m. RNA (codons)

http: //www. youtube. com/watch? v=1 fi. Jupfb Spg&feature=related http: //www. stolaf. edu/people/giannini/flash animat/molgenetics/translation. swf

m. RNA: AUG CCG AUC AUG UAA

Fig. 17 -25 DNA TRANSCRIPTION 3 l Po A y- RNA polymerase 5 RNA transcript RNA PROCESSING Exon RNA transcript (pre-m. RNA) Intron Aminoacyl-t. RNA synthetase y-A Pol NUCLEUS Amino acid CYTOPLASM AMINO ACID ACTIVATION t. RNA m. RNA Growing polypeptide 3 p Ca A P E A y- Activated amino acid Ribosomal subunits l Po Cap 5 TRANSLATION E A Codon Ribosome Anticodon

Mutation • Mutation – a change in the DNA http: //www. bing. com/videos/sear ch? q=DNA+mutation+animation& mid=9 A 0 A 3 B 1 F 3015 EFDFB 4889 A 0 A 3 B 1 F 3015 EFDFB 488&view= detail&FORM=VIRE 3&adlt=strict

mutations • • The cat ate the mouse Tec ata tet hem ouse (deletion) Thh eca tat eth emous (addition) The rat ate the mouse (substitution)

• Effects of change made in the protein can vary – Neutral mutation No effect occurs when the mutation in the DNA does not change the amino acid that is called for – If one base is added (insertion) or deleted (deletion), you get a frameshift mutation • Most devastating http: //highered. mcg rawhill. com/sites/00725 56781/student_vie w 0/chapter 11/anim ation_quiz_4. html

https: //www. youtube. com/watch? v=qe 59 ar. GZmg • Sickle cell • Cystic fibrosis https: //www. youtube. com/watch? v=q. V 30 Zy n. AJfw • Cancer https: //www. youtube. com/watch? v=LEp. TT olebqo

GATCTCTTAGGGTCTTACGCT • CUAGAGAAUCCCAGAAUGCGA • LEUCINE, GLUTAMIC ACID, ASPARAGINE, PROLINE, ARGININE, METHIONINE, ARGININE • CUAGAGAAUACCAGAAUGCGA • LEUCINE, GLUTAMIC ACID, ASPARAGINE, THREONINE, ARGININE, METHIONINE, ARGININE