DNA TECHNOLOGY Transgenic organism Restriction Enzyme GMO genetically

DNA TECHNOLOGY • Transgenic organism • Restriction Enzyme • GMO = genetically modified organism • Gene therapy • Vector • Recombinant DNA • PCR (polymerase chain reaction) • Gel Electrophoresis • Cloning • Stem cells

Transgenic Organisms What are they? Organisms that carry genes from another species The first transgenic organisms were bacteria First transgenic animal happened in 1975 A mouse carried an ape gene +

How in the world did that happen? ! First you find the gene that you want to transfer over Then you must cut that gene out of the parent DNA The area you want to put the DNA in the other organism has to be found Cut the new DNA so you can insert into vector Gene put into its new DNA home

Different restriction enzymes cut DNA at different palindromes

How do you cut the DNA? Use restriction enzymes: Bacterial proteins that have the ability to cut strands of DNA at a specific nucleotide sequence. How does the cut piece of DNA get into the targeted organisms cells? For animals: Transgene put into a vector and then into a fertilized egg For Plants: Transgene put into vector which is put into a bacterium that infects plant cells.

GGAATTCCTTAAGTCAACCGCTTAAGG Gene you want. Makes Human insulin GGAATTCCTTAAGTCAACCGCTTAAGG Cut out by restriction enzymes GTACTGACCCTTGGTA AGAGTACGTTTGT DNA inside vector cut with restriction enzymes

What the heck is a vector? A Vector is a Virus that has been re-engineered A new piece of DNA has been added to the virus and often times the part of DNA that infects you is removed. Transgene

Transgene put into vector DNA GTACTGACCCTTGGTA AGAGTACGTTTGT TTAAGTCAA Vector infects egg Vector puts Transgene into egg DNA Egg put into mother and when baby cow is born it makes human insulin

Vectors • Example: plasmid (small ring of DNA in a bacterial cell • May be biological (viruses or plasmids) • Or mechanical (micropipette or “bullet”

So why don’t we make all kinds of new animals and plants? We don’t know how it will affect our environment If something is wrong with them its not like we can just take them all back up What other effects will it have besides the one intended They can mutate Examples of GMOs (genetically modified organisms) that we have now……… Sterile male crop pests Plants that have an insecticide in them

Gene Therapy What in the world is gene therapy? !? ! The treatment of certain disorders, especially genetic disorders, by introducing specific engineered genes into a patient's cells Several methods can be used when treating a genetic disorder: A normal gene may be inserted into a nonspecific location within the genome to replace a nonfunctional gene. This approach is most common. An abnormal gene could be swapped for a normal gene. The abnormal gene could be repaired, which returns the gene to its normal function. The regulation (the degree to which a gene is turned on or off) of a particular gene could be altered

So how do we do this? A vector is used to deliver the DNA needed to fix the problem into the target cells……the ones that need to be fixed. Just like in transgenic organisms the vector infects the cells and delivers the DNA into the cell to be put into the target cell’s DNA This new DNA changes the target cells so that they are now normal. What kind of disorders are we talking about here? Hemophilia Huntington’s Disease Sickle Cell Anemia Thalassaemia Cystic Fibrosis

So don’t we cure everybody? FDA has not approved gene therapy because it has proven dangerous. Not a permanent cure Our bodies can have an immune response to the vector and DNA. Example of this is France. Many diseases are caused by multi-gene problems

Gene Therapy Cell culture flask Bone marrow cells Hip bone

PCR: polymerase chain reaction • Replicates DNA outside of living organisms • Uses heat and enzymes to make lots of DNA very fast • Used for crime investigations, diagnose diseases (like HIV) and cloning

Recombinant DNA • Made by connecting (recombining) fragments of DNA from different sources

Uses of Recombinant DNA • • Insect resistant crops Growth hormones Insulin for diabetics Higher yielding food plants Clotting factor for hemophiliacs E. coli produces indigo dye to color jeans Cheese, laundry detergents, and sewage treatment are enhanced by recombinant DNA

GEL ELECTROPHORESIS

Loading the well with DNA

Steps of Gel Electrophoresis: • Restriction enzymes cut DNA into fragments. The fragmented DNA is injected into wells in the gel. A current is sent through the gel and the fragments will move at different speeds that appear as bands under UV light. Bands can be matched up to identify criminals, bodies or fossils or to determine parentage. Longer fragments move slower than short ones.

Send a current through the gel

Fragments will move at different speeds, creating bands that appear under UV light

Bands can be matched up to identify parents, children, or criminals

Cloning • Making an identical genetic copy Dolly, 1997 News report

Stem Cells • Undifferentiated cells that can be genetically engineered to express the genes for any desired type of tissue – Usually embryonic = controversial – But is there another way…? • Often used in regenerative medicine – Current research hopes to treat diseases such as Parkinson's disease, Alzheimer's disease, spinal cord injury, heart disease, diabetes and arthritis.

Plasmid Activity: p. 355 in textbook • • • Write the letters on the LONG strip: GGATCC CCTAGG Write the letters on the SHORT strip: GGATCC CCTAGG Make sure all letters are equally spaced

Plasmid activity p. 354 -355 • Tape the ends of the shorter strip together. • This is the plasmid • Cut the longer strip of DNA in 2 places at the palindrome GIGATCC. This is the foreign DNA. Cutting it represents restriction enzymes. • Cut the plasmid in the same way. • Insert the foreign gene into the plasmid and tape together.