DNA Structure and Function DNA Structure and Function

DNA Structure and Function

DNA Structure and Function KEY CONCEPTS VOCABULARY • Who helped discover DNA? • What does DNA do for us? • What is the structure of DNA? • What is DNA made of? • • DNA Adenine Guanine Cytosine Thymine Purines Pyrimidines Nucleotide

DNA • DNA stands for deoxyribonucleic acid • Large molecule that contains all genetic information • Functions of DNA: – Directs the activities of cells – Contains the instructions cells use to make proteins • What kinds of things do living organisms use proteins for?

History • Rosalind Franklin took the first x-ray pictures of DNA molecules • The x-ray pictures helped scientists to determine the shape of DNA. • What is the shape of a DNA molecule?

History • James Watson and Francis Crick built the first DNA model • They are given credit for first determining the double helix shape

Structure • A strand of DNA is made of monomers called nucleotides • Each nucleotide has three parts: 1. Sugar (deoxyribose) 2. Phosphate 3. Nitrogen base • The nitrogen base always binds to the sugar of a nucleotide

Structure There are four different DNA nitrogen bases: 1. 2. 3. 4. • • Adenine Guanine Cytosine Thymine Adenine and guanine are single-ringed purines Cytosine and thymine are double-ringed pyrimidines

Structure • Label the following parts of the DNA nucleotides below: adenine, thymine, guanine, cytosine, purines, pyrimidines, phosphate, and sugar

Structure • Nucleotides bond together to form a double stranded DNA molecule • DNA’s structure looks like a twisted ladder – This structure is called the double helix • The deoxyribose and phosphate form the “sidepieces, ” of the ladder. • Nitrogen bases bond together to form the “rungs, ” of the ladder.

Structure

Structure • Label the following parts of the DNA molecule below: nucleotide, hydrogen bonds, sugar-phosphate backbone Nucleotide Sugarphosphate backbone Key Adenine (A) Thymine (T) Cytosine (C) Guanine (G)

Chargaff’s Base Pairing Rules • Adenine always bonds to thymine • Cytosine always bonds to guanine • The nitrogen bases are bonded with weak hydrogen bonds • Why do only certain nitrogen bases bind to each other?

Chargaff’s Base Pairing Rules • Complete the other half of the DNA molecule below using Chargaff’s base pairing rules: ATGAACGTCACCGTACATCGT

DNA and Chromosomes • In eukaryotic cells, DNA molecules are tightly wound into chromosomes • Where are chromosomes located in eukaryotic cells? • Chromosomes contain all the DNA needed to carry out cellular functions

DNA and Chromosomes • Label the following parts of the diagram below: double helix, chromosome, supercoils, histones, proteins Histones