DNA stands for Deoxyribonucleic Acid DNA makes up

DNA stands for Deoxyribonucleic Acid

• DNA makes up chromosomes and genes.

• DNA is made up of repeating subunits or monomers called nucleotides.

3 Parts of a DNA Nucleotide Phosphate Group O O=P-O O 5 CH 2 O N C 1 C 4 Deoxyribose sugar C 3 C 2 Nitrogen base

4 DNA Nitrogenous Bases 1. Adenine 2. Thymine 3. Guanine 4. Cytosine (A) (T) (G) (C) A or G T or C

Base-Pairing Rules • Adenine (A) always pairs with Thymine (T) • Guanine (G) always pairs with Cytosine (C) T A G C

BASE-PAIRINGS H-bonds G C T A

A DNA molecule is shaped as a double helix (like a twisted ladder)

The two scientists credited with the discovery DNA’s double helix shape are James Watson and Francis Crick

However, Watson and Crick would not have made the discovery without the research of Rosalind Franklin.

§The sugar and phosphate part of the nucleotide make up the sides of a DNA molecule. The bases make up the middle of the DNA molecule.

If you compare DNA to a ladder: • The bases make up the “rungs” of The DNA “ladder”. • The “sides of the ladder are made up of the sugar and phosphate molecules. “Rungs of ladder” Nitrogenous Base (A, T, G or C) “Legs of ladder” Phosphate & Sugar Backbone

DNA Double Helix 5 O 3 3 P 5 O O C G 1 P 5 3 2 4 4 2 3 P 1 T 5 A P 3 O O P 5 O 3 5 P

• A gene is a stretch of DNA that codes for a trait.

• Different arrangements of nucleotides in DNA provide the key to diversity among living organisms.

The Code of Life… • The traits controlled by a gene are determined by the order or sequence in which the bases occur. 3' end (START CODON ->)TACCACGACAGAGGACGGCTGTTCTGGTTGCAGTTCCGGCGGACCCCGTTCCAACCGCGCGTGCGACCGCTCATACCACGCCTCCG GGACCTCTCCTACAAGGACAGGAAGGGGTGGTGGTTCTGGATGAAGGGCGTGAAGCTGGACTCGGTGCCGAGACGGGTCCAATTCCCG GTGCCGTTCTTCCACCGGCTGCGCGACTGGTTGCGGCACCGCGTGCACCTGCTGTACGGGTTGCGCGACAGGCGGGACTCGCTGGAC GTGCGCGTGTTCGAAGCCCACCTGGGCCAGTTGAAGTTCGAGGATTCGGTGACGACCACTGGGACCGGCGGGTGGAGGGGCGG CTCAAGTGGGGACGCCACGTGCGGAGGGACCTGTTCAAGGACCGAAGACACTCGTGGCACGACTGGAGGTTTATGGCAATTCGACCTC GGAGCCATCGTCAAGGAGGACGGTCTACCCGGAGGGTTGCCCGGGAGGAGGAACGTGGCCGGGAAGGACCAGAAACTTATTT CAGAC TCACCCGCCG 5' end Base sequence for a human blood protein

DNA is Complementary: Example A T G G G C T A C C C G A T

You try one! G T G C A A C G C G T T

Review • What is the nucleic acid that stores and transmits genetic information from one generation of organisms to the next? • DNA

Review • DNA shape is a ______ • Double helix

Review • A ______ is a stretch of DNA that codes for a trait. • gene • The code is the order of the _____ (ATCG) • bases

Review • A always pairs with _____ • T • G always pairs with ____ • C

Review • What is the base sequence of the DNA strand that would be complementary to the following single-stranded DNA molecule? GGATCTGATCCAGTCA • CCTAGACTAGGTCAGT

Review: DNA Nucleotide Phosphate Group O O=P-O O 5 CH 2 O N C 1 C 4 Sugar (deoxyribose) C 3 C 2 Nitrogenous base (A, G, C, or T)

Review Made of monomer building blocks called nucleotides _________. From the Virtual Cell Biology Classroom on Science. Prof. Online. com Image: Nucleotide Structure, Wikipedia

Review: DNA Structure • What two parts of a DNA nucleotide make up the sides of the DNA “ladder”? Sugar & Phosphate Group

Review: DNA Structure • What parts of the DNA nucleotide make up the “rung” of the “ladder”? Nitrogen-containing bases

Review: What is the structure below? DNA nucleotide

Base Pairing

• Every time your cells divide to produce new cells, DNA must be copied. • The process by which DNA is copied during the cell cycle is called replication

• Replication ensures every cell has a complete set of identical DNA.

• Replication occurs before mitosis and meiosis

• DNA is complementary. • Due to base pairing, if you know the sequence of bases on one side of a DNA molecule, you will always know the base sequence on the other side.

• During DNA replication, the original DNA acts as its own model or template since each nucleotide has an exclusive partner. • The new DNA molecules each consist of one original strand one newly made strand.

• For example, a strand that has the bases AGACTCAGG produce a new strand with bases TCTGAGTCC • This is known as semi-conservative DNA replication.

STEPS FOR DNA REPLICATION 1. An enzyme “unzips” the DNA molecule between the base pairs forming two strands.

DNA replication – helix unzips

2. Using the original strands of DNA as a template, free-floating nucleotides pair up with the exposed bases on each template strand. An enzyme bonds the bases together.

3. Two identical double-stranded molecules of DNA result. Each new strand of DNA contains one original strand one new strand.

COMPUTER ANIMATION DNA REPLICATION

What is the base sequence for the new strand after replication ?

DNA Replication-Review Existing DNA molecule 2 DNA molecules formed Unzipping of DNA molecule Nucleotides added

From DNA to Protein 8. 4 Transcription

DNA TO RNA: TRANSCRIPTION • DNA contains the code for making proteins which make up the organism. • Cells cannot make proteins directly from DNA. • A helper molecule is needed-called RNA

Transcription RNA to DNA • DNA is the master copy of the instructions for making proteins and must stay in the nucleus where it is protected.

• An intermediary nucleic acid is used called RNA (ribonucleic acid) which takes the "message" of the DNA to the ribosomes and "tells them" what proteins are to be made.

Three main differences in DNA and RNA 1) DNA sugar is Deoxyribose RNA sugar is ribose

2) DNA has 2 strands • RNA has 1 strand

Bases RNA has Uracil (U) instead of Thymine (T) DNA RNA • Thymine (T) • Adenine (A) • Guanine (G) • Cytosine (C) • Uracil (U) • Adenine (A) • Guanine (G) • Cytosine (C)

Process of Transcription DNA to RNA • Before cells can make proteins DNA must be copied to produce a strand of RNA. • This process is called TRANSCRIPTION.

Process of Transcription DNA to RNA • Transcription occurs in the nucleus of the cell.

Stages of Transcription • An enzyme recognizes and binds to the start of a gene. • The enzyme “unzips” the DNA.

Stages of Transcription • Using one DNA strand as a template, the enzyme strings together a complementary strand of RNA nucleotides.

• During the creation of the RNA strand, the same base pair rules apply, except uracil, not thymine, pairs with adenine.

• When the entire gene has been transcribed the RNA detaches from the DNA. • m. RNA moves out of the nucleus and into the cytoplasm to the ribosome for the next step in the protein making process.

Transcription

3 kinds of RNA üMessenger RNA (m. RNA) üRibosomal RNA (r. RNA) üTransfer RNA (t. RNA)

• The specific type of RNA that carries DNA’s instructions for making proteins is called messenger RNA or m. RNA.

Transcription DNA to RNA

Review: RNA AND PROTEIN SYNTHESIS

DNA RNA Protein Nuclear membrane DNA Transcription Eukaryotic Cell Pre-m. RNA Processing m. RNA Ribosome Translation Protein

Transcription of m. RNA

Question: • What would be the complementary RNA strand for the following DNA sequence? G C G T A T G CGCAUAC

8. 5 Translation-RNA to PROTEIN • Translation is the process that converts or translates m. RNA into a protein. • Occurs in the cytoplasm on the ribosomes

Main Idea: Amino acids are encoded by m. RNA base sequences. start codon m. RNA A U G G G C U C C A U C G G C A U A A codon 1 protein methionine codon 2 codon 3 glycine serine codon 4 isoleucine codon 5 codon 6 glycine alanine codon 7 stop codon

Messenger RNA (m. RNA) start codon m. RNA A U G G G C U C C A U C G G C A U A A codon 1 protein methionine codon 2 codon 3 glycine serine codon 4 isoleucine codon 5 codon 6 glycine alanine codon 7 stop codon Primary structure of a protein aa 1 aa 2 aa 3 peptide bonds aa 4 aa 5 aa 6

Proteins are made by joining amino acids into long chains.

• There are 20 different amino acids.

• The order of the amino acids determines which proteins will be made.

• The sequence of the bases on the DNA (ATCG) and RNA (AUCG) determine the sequence of the amino acids that make up the protein.

• In the genetic code, a sequence of three nucleotides called codons provide the code for one amino acid.

The genetic code chart represents the sequence on the m. RNA codon. All living organisms and viruses use this triplet genetic code - its that "biological unity" idea again!!!

How to read m. RNA • P 244 start codon m. RNA A U G G G C U C C A U C G G C A U A A codon 1 codon 2 codon 3 codon 4 codon 5 codon 6 codon 7 protein methionine glycine serine isoleucine glycine alanine stop codon

• Ribosomes CAN’T actually read the information in the m. RNA. • We need another type of RNA that can “read” it called transfer RNA, or t. RNA.

• t. RNA has an anticodon that is complementary to one of the m. RNA codons. • t. RNA also has an amino acid attached to it that matches up with the m. RNA codon.

• The Central Dogma states that information flows in one direction, from DNA to RNA to PROTEINS.

Central Dogma States: • Replication copies DNA • Transcription converts a DNA message to an intermediate molecule called RNA. • Translation interprets an RNA molecule into a string of amino acids (protein)

Transfer RNA (t. RNA) amino acid attachment site methionine U A C anticodon amino acid

Translation The m. RNA is “threaded” between two subunits of the ribosome. Large subunit m. RNA A Small subunit U G U U U C G

Translation A “start” codon on the m. RNA signals the beginning of a protein chain. START m. RNA A U G U U U C G

A t. RNA with anticodon UAC can now bind to m. RNA because bases match up. met 1 -t. RNA anticodon U A C A U G codon U U U C G m. RNA A

The amino acid methionine from the t. RNA becomes the first amino acid on the new protein strand met 1 -t. RNA anticodon U A C A U G codon U U U C G m. RNA A

Another t. RNA with the complementary anticodon to the next codon on the m. RNA. . Phe met 2 -t. RNA 1 -t. RNA anticodon U A C A U G codon A A U U U C A G m. RNA A

…joins with its amino acid met Phe 1 -t. RNA anticodon U A C A U G codon 2 -t. RNA A U A U C U U C G m. RNA A

Peptide bond formation between the amino acids peptide bond met Phe 1 -t. RNA anticodon U A C A U G codon 2 -t. RNA A U A U C U U C G m. RNA A

peptide bond ? ? ? met Phe 3 -t. RNA 1 -t. RNA anticodon U A C A U G codon G 2 -t. RNA A U A A A U C U U C G m. RNA A

• The first t. RNA leaves to go get another amino acid making room for another t. RNA to land…the chain grows!!!

met peptide bond leu Phe 1 -t. RNA U A 3 -t. RNA C (leaves) G 2 -t. RNA A A U G U A A U C U U C G m. RNA Ribosomes move over one codon A A

peptide bonds met ? ? ? phe leu 4 -t. RNA 2 -t. RNA A A U G U A U G 3 -t. RNA G A C U A U C G A A C m. RNA U

peptide bonds met Ala Phe leu 2 -t. RNA A A 4 -t. RNA A (leaves) A U G 3 -t. RNA G U U U G A C U C A U C G A A C m. RNA Ribosomes move over one codon U U

peptide bonds aa 5 aa 1 aa 2 aa 4 aa 3 5 -t. RNA U 3 -t. RNA G G U U U C A U G 4 -t. RNA A U G C U C G A A C U m. RNA A

peptide bonds aa 1 aa 5 aa 2 aa 3 aa 4 5 -t. RNA U 3 -t. RNA G G A U G 4 -t. RNA U C U U G C U C G A A C U m. RNA Ribosomes move over one codon A

Time to stop!!! • When a stop codon is reached, there is no anticodon for it, so the ribosome falls apart releasing the new protein.

aa 5 aa 4 aa 3 aa 199 aa 200 primary structure of a protein aa 2 aa 1 200 -t. RNA A C m. RNA U C A U G U U terminator or stop codon U A G

End Product • The end products of protein synthesis is a primary structure of a protein • A sequence of amino acid bonded together by peptide bonds aa 5 aa 2 aa 1 aa 3 aa 4 aa 199 aa 200

Video clip