DNA stands for Deoxyribonucleic Acid DNA is too

DNA stands for: Deoxyribonucleic Acid DNA is too small to see. Every living thing has DNA. That means that you have something in common with a zebra, a tree, a mushroom and even bacteria!!!

Contributors to DNA • Erwin Chargraff- showed that percentages of Adenine and Thymine are equal in an organism, just as Cytosine and Guanine. • Rosalind Franklin- took x-ray diffraction pictures that revealed the DNA double helix James Watson and Francis Crickdescribed the model of the DNA molecule that explained the structure & properties (double helix, a twisted ladder)

The 2 Major Functions of DNA S It’s the Universal Genetic code for inheritance S Protein Synthesis

What is DNA? S DNA is a Nucleic Acid S Polymer of Nucleotides S Each nucleotide consists of S 5 -carbon sugar (called DEOXYRIBOSE) S Phosphate group S A nitrogen-containing base S Four bases S Adenine, Guanine, Thymine, Cytosine

Each person has a unique combination of proteins that determines their physical characteristics!

DNA is made up of NUCLEOTIDES nucleotide S Serve as the alphabet for the language of life! S One strand of DNA has many millions of nucleotides. 9

3 parts of a Nucleotide

Parts of a Nucleotide S The phosphate group and 5 carbon sugar are the DOUBLE HELIX BACKBONE! Bases are held together by WEAK HYDROGEN BONDS! • The nitrogen bases (C, G, A, T) hold the DNA CODE.

All organisms have the same 4 DNA bases, just in different order! DNA has four different bases: S Cytosine C S Thymine T S Adenine A S Guanine G 12

The most common organic bases are Adenine (A) Thymine (T) Cytosine (C) Guanine (G) 5

Two Kinds of Bases in DNA N S Pyrimidines are single ring bases N O C C C, T C N S Purines are double ring bases. N C C A, G C N Remember: “PURE AS GOLD” 14 C N N C

Thymine and Cytosine are pyrimidines S Thymine and cytosine each have one ring of carbon and nitrogen atoms. N O C C N N C O C C N C C cytosine thymine 15

Adenine and Guanine are purines S Adenine and Guanine each have two rings of carbon and nitrogen atoms. O N N N C C C C N N N Adenine N C N Guanine C 16 C C N

Two Stranded DNA S Remember, DNA has two strands that fit together something like a zipper. S The teeth are the nitrogenous bases but why do they stick together? 17

Hydrogen Bonds N C S The bases attract each N C N 18 C cytosine and guanine are shown here with dotted C C S The bonds between O S Hydrogen bonds are weak but there are millions and millions of them in a single molecule of DNA. N N other because of hydrogen bonds. N C C C N O

Hydrogen Bonds, cont. O N S When making O hydrogen bonds…. use Chargoff’s Rule C C N C S C=G N S Adenine always pairs up with Thymine C N S Cytosine always pairs up with Guanine C 19 C N C

Chargaff's Rule: • Adenine always pairs with who? ? • Cytosine always pairs with who? ? 20 S

If DNA is 20% thymine how much adenine will it have? S (Hint: whatever thymine pairs with will also have the same amount) If DNA is 30% cytosine how much adenine will it have? If DNA is 35% guanine how much thymine will it have?

DNA is written out like this: S CTCGAGGGGCCTAGACATTGCCCTCC AGAGCACCCAACACCCTCCAGG CTTGACCGGCCAGGGTGTCCCCTTCC TACCTTGGAGAGAGCAGCCCCAGGGC ATCCTGCAGGGGGTGCTGGGACACCA GCTGGCCTTCAAGGTCTCTGCCTCCC TCCAGCCACCCCACTACACGCTGCTG GGATCCTGGA

S https: //www. youtube. com/watc h? v=qy 8 dk 5 i. S 1 f 0

DNA Name Sugar Location Bases # of strands RNA