DNA replication transcription and translation Chapter 10 What

DNA replication, transcription and translation Chapter 10

What is DNA • Structure • Replication

DNA Replication • Replication begins at origin of replication – Helicase melts the double-stranded DNA – RNA primase initiates the chains – DNA polymerase replicates the DNA – DNA ligase seals breaks in sugar-phosphate backbone • Creates two replication forks – Leave origin going in opposite directions; bidirectional • Leading vs lagging strands (DNA is anti-parallel) – DNA polymerase works 5’ to 3’ – one strand is easy – Other one done in short pieces “Okazaki fragments” by DNA polymerase and ligase working together

DNA replication fork

Leading vs lagging strand

DNA Replication – the nitty gritty • Helicases “unzip” DNA strands – What is being disrupted? Why is this necessary? • RNA primase puts in short primers – DNA polymerase can only add nucleotides, not initiate • DNA polymerase synthesize 5’ to 3’ direction – Hydrolysis of high-energy phosphate bond powers

5’ to 3’ orientation • • • DNA is double stranded 2 linear sequences Held together by H bonds complementary ANTIPARALLEL: 5’ to 3’ • Orientation is opposite for each strand

Chemistry – adding bases

DNA Replication – the nitty gritty • The two strands are replicated differently – Leading strand synthesized “continuously” – Lagging strand synthesized discontinuously • • DNA polymerases only adds nucleotides to 3’ end Primase makes primers DNA polymerase replaces primers DNA ligase forms covalent bond between adjacent nucleotides

DNA Replication – the nitty gritty Replication fork Leading – pol goes straight - one chain Lagging – bunny hops - pieces 5’ 5’

A bacterial cell that had a mutation in the gene for Primase (RNA polymerase) such that the enzyme did not function would NOT be able to A. Synthesize the leading strand only B. Synthesize the lagging strand only C. Synthesize either the leading or lagging strand

What it’s all for? • • What does DNA do? Instructions for protein! How does it do this? Transcription and translation

“CENTRAL DOGMA” of Molecular Biology: l DIY Manua SELECTIVE USE Are all genes “ON” at any given time? How to m Oxygen ake tongs O 2

3 terms • Replication • Transcription • Translation

3 terms • Replication – Make DNA from DNA (cell division) • Transcription – Make RNA from DNA (small copy) • Translation – Turn RNA into protein (ribosome)

Compare DNA and RNA

DNA Review • Chains of nucleotides • Sugar-PO 4 backbone with base A, G, C or T • Chains held by H bonds – A-T (2) – C-G (3) • 5’ & 3’ ends – 5’ has the phosphate – 3’ has OH group for next nucleotide

RNA • Nucleotides – Ribose sugar – Bases – A, U, C, G • Single stranded – But may be folded

RNA types • 3 main types – m. RNA • Carries information from DNA to ribosome – r. RNA • Part of structure and function of ribosome – t. RNA • Carries amino acids to ribosome • Decodes m. RNA

Using the DNA to make protein • Central dogma: DNA m. RNA protein • transcription and translation • Compare this to replication n transcription ns a r t io lat transcription Why do things this way? Why not go from DNA straight to protein?

Gene Expression: DNA m. RNA protein • http: //www. youtube. com/watch? v=41_Ne 5 m. S 2 ls&feature=related

Now the details

Transcription Terminology • RNA polymerase – Enzyme synthesizes RNA from DNA in 5’ to 3’ • Promoter – Sequence in DNA – Marks beginning of genes • Transcription Terminator – Sequence in DNA – Marks ends of genes

Copyright © The Mc. Graw-Hill Companies, Inc. Permission required for reproduction or display. 3' 5' Promoter Transcription terminator RNA polymerase INITIATION 5' 3' 3' 5' Sigma Template strand 5' ELONGATION 3' 3' Promoter 5' 5’ to 3’ direction 5' TERMINATION 3' 5' m. RNA G A CU G C T GA C 3' 5' Promoter 5' Hairpin loop RNA polymerase dissociates from template.

Initiation • RNA Polymerase binds promoter • Gets oriented – Which way to go – Which strand to use • Begins opening the DNA

Elongation • Brings in complementary RNA nucleotides to the DNA nucleotides in its active site • C-G • G-C • T-A • A-U DNA RNA

Transcription – up close

Termination • RNA polymerase reaches the terminator • RNA polymerase is bumped off the DNA • Transcription ends

Transcription vs replication • Synthesis of RNA from DNA – Compare this to DNA replication – similar, different • RNA polymerase opens the DNA and then transcribes – What enzymes did this in DNA replication? • Binds to promoter (upstream of genes) – Does replication machinery bind and start here? • Stops at terminator (transcription ends) – Does replication stop here?

True or false: All the information in the DNA of cell is organized into genes that code for proteins. A. True B. False

Which of the following is the best description of the role of RNA polymerase? A. B. C. D. To translate m. RNA into protein To replicate the DNA To copy the code in the DNA into m. RNA To synthesize several types of RNA using the code in the DNA E. To degrade polymers of RNA

True or false: during the process of transcription, DNA and RNA nucleotides bind to each other by hydrogen bonds A. True B. False

Translation – reagent, product, enzyme? Figure 8. 2

Translation – RNA DNA by ribosome Figure 8. 2

Translation – what is the m. RNA language? • Carries DNA information • translated in codons (3 nucleotides) • begins at start codon: AUG • ends at nonsense codons: UAA, UAG, UGA • 64 sense codons encode 20 amino acids • The genetic code is degenerate

questions • Where does transcription start and stop? • Where does translation start and stop?

questions • Where does transcription start and stop? – Promoter and terminator in DNA • Where does translation start and stop? – Start and stop codons in m. RNA

Translation table

Codons • Start codon – AUG closest to 5’ end – Codes for Met – Marks beginning – Sets reading frame • Stop codon – UAA, UAG, UGA – Marks end – No amino acid

t. RNA • Carries amino acid • Decodes m. RNA – Anticodon • 3 nucleotides complementary to codon

ribosomes • • Are they an organelle? What are they made of? Where are they assembled in eukaryotes? Are they identical in prokaryotes and eukaryotes? • How many subunits do they have? • Are the two subunits always together?

The Process of Translation Figure 8. 9

The Process of Translation Figure 8. 9

The Process of Translation WHAT CHEMICAL REACTION IS THIS? Figure 8. 9

The Process of Translation Figure 8. 9

The Process of Translation Figure 8. 9

The Process of Translation Figure 8. 9

The Process of Translation Figure 8. 9

The Process of Translation CAN THIS RIBOSOME MAKE ANY PROTEIN OR ARE RIBOSOMES DEDICATED TO SUBSET RNAs? Figure 8. 9

When m. RNA is translated, the “reading frame” is directly determined by A. The location of the start codon closest to the 5’ end of the m. RNA B. The position of the promoter in the DNA C. The position of the stop codon D. None of the above are correct

practical • DNA sequence of a gene 5’ 3’ GATTACGATGAAACGGAGACAGUGATATAGG • Provide the

Practical - replication • DNA sequence of a gene 5’ 3’ GATTACGATGAAACGGAGACAGTGAGGTATA • Provide the other strand • Origin of replication is underlined • Describe how each strand will be replicated

Start here Monday

Practical - transcription • DNA sequence of a gene 5’ 3’ GATTACGATGAAACGGAGACAGUGAGGTATA • Promoter on left and terminator on right underlined • Write the m. RNA of this gene – include orientation and make sure to use U not T

Practical - translation • Use your m. RNA sequence • Locate your START codon and STOP codon • Use the chart to predict the protein:

Let’s determine our PTC genotype! • Begin digestion • Discuss – Restriction enzyme function – Gel electrophoresis • Gels are pre-poured – Load samples – Run gel – Observe and interpret the results!

Coming up… • Sun 3/6– 1 st attempt – Quiz division, genetics and DNA • Monday 3/7 – Natural selection prelab • Wednesday 3/9 – Test 3 (Ch 8 -9 – division, genetics) • Sun 3/13– 2 nd attempt – Quiz division, genetics and DNA • Wednesday 3/16 – Comp. final Ch 1 -13 (more DNA, selection)