DNA Replication and Protein Synthesis Review by Holly

DNA Replication and Protein Synthesis Review by Holly Palumbo Swick

DNA Replication 1. Place the steps of replication in order DNA helicase unwinds andnew breaks hydrogen bonds separating DNA strands Replication fork forms proofreads the newly made DNA strands DNA polymerase adds nucleotides to the growing DNA strand Topoisomerase prevents supercoiling upstream from the replication DNA Ligase connects okazaki fragments ontothe discontinuous strand fork Primase adds RNA nucleotides creating primer Single stranded binding proteins attach DNA strands

DNA Replication 1. Label the following structures in the DNA replication diagram Discontinuous strand Continuous strand Okazaki fragment Parent strand

DNA Replication 1. Label the following structures in the DNA replication diagram Discontinuous strand Continuous strand Okazaki fragment DNA polymerase primase DNA helicase Single stranded binding proteins Topoisomerase primer DNA Ligase

Transcription Steps 1. Place the steps of transcription in order that they occur RNARNA polymerase attaches to the TATA start sequence in promoter region polymerase adds nucleotides to the growing RNA strand RNA stops adding nucleotides when from it reaches the template TTATTT sequence RNA polymerase separates the DNA Transcription factors attach to the promoter region on DNA 2. Label the steps above as part of initiation, elongation, termination Initiation elongation termination

Transcription Goal- protein production/gene expression of Gene B 1. Use the DNA strands, RNA polymerase and transcription factors to show initiation of transcription Gene B 5’ 3’ ATATGGC ATGATGCGAAGATTCAGTACAGCCGCTAGGTCAATAAA 3’ TATACCG TACTACGCT TCTA AGTCATGTCGGCGATCCAGTTATTT 5’ Gene A Transcription factor RNA Polymerase 2. slide the following terms to their correct location in the diagram above enzyme Promoter region Minus strand Coding strand Non-coding strand Antisense strand Template strand sense strand Regulatory protein Termination sequence

Transcription 1. Use the purple rectangle to Transcribe the correct strand that will allow for the production of protein B Gene B 5’ ATATGGC Transcription RNA Polymerase factor 3’ TATACCG ATGATCCGAAGATTCAGTACAGCCGCTAGGTCAATAAA 3’ TACTAGGCT TCTA AGTCATGTCGGCGATCCAGTTATTT 5’ Gene A

RNA Processing 1. Process the pre- m. RNA to produce mature RNA. - Blue pieces are introns and Yellow pieces are exons AAAAAAAA 5’ GTP cap Pre-m. RNA Mature m. RNA AUGAUC CGA AGA UUC AGU ACGUAC AGC CGC UAGGUC AAUAAA

Translation Steps 1. Translate the mature RNA into a polypeptide Ribosome slides over 1 codon t. RNA’s continue to bringamino acids into open Ato site and amino Amino New acid t. RNA in P brings site moves over and acid peptide based on bonds codon amino in A site acid in A site Small ribosome subunit attaches to start sequence on m. RNA t. RNA brings over first amino acid based on codon in P site Large ribosome subunit Release factor enters Aattaches site acids continue to peptide bond 2. Label the steps above as part of initiation, elongation, termination Initiation elongation termination

Translation 1. Translate the mature RNA into a polypeptide chain AUG AUC AGA AGU AGC UAG GUC m. RNA large ribosome subunit ILE P A U A G ARG SER MET SER U A C UCA UCG AUC UCU