DNA Mav Mark Mav Mark Mav Mark Organic

DNA

Mav Mark

Mav Mark

Mav Mark

Organic Compounds l Any compound that contains BOTH Carbon (C) – Methane CH 4 – Glucose C 6 H 12 O 6

Organic Compounds for Metabolism l l Carbohydrates Lipids Proteins Nucleic Acids

Carbohydrates and Lipids l Carbohydrates – Provide Energy – Contain C, H, O in a 1: 2: 1 ratio l l l C 6 H 12 O 6 C 5 H 10 O 5 Lipids – Store Energy – Contain C, H, O; but have less Oxygen than Carbohydrates

Proteins and Nucleic Acids l Proteins – Important for body-building material (muscles) – Made from Amino Acids – Contain C, H, O, and N l Nucleic Acids – Helps to store cellular information – Includes DNA and RNA – Contain C, H, O, N, and P

DNA The Blue Print of Life l Deoxyribo. Nucleic Acid l Contains the genetic information used for our growth and development Credit for structure is given to Watson and Crick. l

What DNA is Composed Of l l l Double stranded DNA is made up of Nucleotides Each nucleotide has: – A 5 -carbon sugar: Deoxyribose – A phosphate – A nitrogen base

The Nitrogen Bases l The four Bases of DNA are: – Adenine (A) – Thymine (T) – Cytosine (C) – Guanine (G) l The base pairing are: – Adenine with Thymine – Cytosine with Guanine

Purines and Pyrimidines l Purines: 1 ring – Adenine (A) – Guanine (G) l Pyrimidines: 2 rings – Thymine (T) – Cytosine (C) l Purines can only pair with Pyrimidines

Structure of DNA l Structure – Two strands twisted together (helix) – Sides of Ladder l Alternating and Sugar Phosphate – Rungs of Ladder l Pair of nucleotide bases

Replication l l l Replication is the process of duplicating DNA Two identical copies of DNA result The process occurs: – in the nucleus – During the s-phase of the cell cycle

Replication Process l l l DNA Helicase unzips the double helix Free-floating nucleotides from within the nucleus “repair” each side Two new and identical structures result – Complimentary (original strand) – Template (newly formed strand)

Replication Practice l l l Where does replication take place? During what phase of the cell cycle? Practice: – Template: ATTGCAGGCCTTAGTCAC – Replicate:

More Practice l AGTTCAGCGGTATTAGCAACCGT

RNA l l Ribo. Nucleic Acid RNA is made of nucleotides Single stranded Each nucleotide has – 5 -carbon sugar; Ribose – Phosphate group – Nitrogen Base

The RNA Bases l The four bases of RNA are: – Adenine – Uracil – Cytosine – Guanine l The base pairs are – Adenine and Uracil – Cytosine and Guanine

Comparing DNA and RNA DNA RNA 2 strands 1 strand Deoxyribose sugar Adenine - Thymine Cytosine - Guanine Ribose Sugar Adenine - Uracil Cytosine - Guanine Made by Replication Made by Transcription

Types of RNA l Three Types: – m. RNA: (messenger) Takes code from DNA in nucleus to ribosome – t. RNA: (transfer) Brings amino acids to the ribosome to build proteins – r. RNA: (ribosomal) Makes up ribosomes

Transcription l l l RNA polymerase unzips the DNA structure Free-floating RNA nucleotides repair ONE SIDE of the structure The new m. RNA strand leaves the nucleus to go to a ribosome in the cytoplasm

Transcription Practice l l DNA strand: ATACTGTCAGTATGGCCAT RNA strand: Practice problem: TATTACGACCCGTACTAGAATG

Reverse Transcription l DNA strand: l RNA strand: UAGGCUACUGAUCCAAUG

Proteins l l There are 20 different amino acids that join together to make proteins The amino acids are joined by peptide bonds AA + AA = Protein

Codons l l Codons are groups of three nitrogen bases They signal for specific amino acids – CUC (Leucine) – ACC (Threonine) l Some codons start or stop protein synthesis – – AUG (Start) UAA (Stop) UAG (Stop) UGA (Stop)

Facts About Translation l l It is also called Protein Synthesis It occurs – At a ribosome – In the cytoplasm

Translation (Protein Synthesis) l l l m. RNA breaks into codons and signals specific amino acids t. RNA brings the amino acid to the ribosome Each amino acid bonds to another to form a protein

Transcription and Translation

Translation Practice l l l m. RNA: Amino acid: Practice m. RNA: t. RNA: Amino acid: AUG AGC UGG GGG UAU UAG Met Ser Leu Gly Tyr Stop AUG UGU AGC CCU AUU UAA

Central Dogma of Protein Synthesis

Mutation l l Mutations any changes to either DNA or RNA. Causes: copying errors in the DNA during mitosis and by exposure to ultraviolet radiation, xrays, radioactivity, or viruses. Results: genetic disorders, death, or have no affect. Most mutations are repaired by enzymes.

Mutations l Chromosome – – – Insertion Deletion Translocation Substitution Nondisjunction l Gene – Point – Frameshift

Insertion l Insertion: the addition of one or more nucleotide base pairs into a genetic sequence – Ex: Normal: AAACCCGGG Mutated: AAACACCGGG

Deletion l l Deletion: part of a chromosome or a sequence of DNA is missing. Any number of nucleotides can be deleted, from a single base to an entire piece of chromosome. Example Normal: AAACCCGGG Mutated: AAACCGGG l

Substitution: one or more nucleotides are substituted by the same number of different nucleotides. l In most cases, only one nucleotide is changed. l Example: Normal: AAACCCGGG Mutated: AAACACGGG l

Gene Mutations l Frame-shift mutation: l causes a change all the way down a DNA sequence, making each codon a different sequence. (MORE SERIOUS!) EX. CAG TTC CTG GAA -> (frameshift)-> CAG TTA CCT GGA – Insertion – Deletion l Point-shift mutation: l a single letter is the only thing changed in the DNA sequence EX. GTA CTG CAA-----> (point mutation) -----> GTA GTG CAA – Substitution

Viruses

Virus l Virus is a tiny non-living particle that enters and then reproduces inside a living host cell.

Characteristics of Viruses l l l Have either DNA or RNA. May be single stranded or double stranded. Nonliving because cannot: – – – l make food take in food use energy respond to stimuli make waste multiply on their own. A Bacteriophage is a virus that infects bacteria.

Virus Shape and Size l l Viruses are smaller than bacteria (measured in nanometers) Structure: (2 main Parts) – Protein Coat – Inner Genetic Material (DNA or RNA)

Virus Shapes and Sizes

Lytic Cycle: l Lytic Cycle: Virus enters cell and uses cell to reproduce. (Ex. Flu, Rhinovirus) – Viral DNA destroys Cell DNA, takes over cell functions and destroys the cell. – The Virus replicates. – There are symptoms of viral infection. – Active viral infection takes place.

Lysogenic Cycle l Lysogenic Cycle: Virus enters cell and becomes part of cells DNA. May enter lytic cycle if exposed to stress. (Herpes, cold sores. ) – Viral DNA merges with Cell DNA and does not destroy the cell. – There are no symptoms of viral infection. – Passive viral replication takes place.

Lysogenic/Lytic Cycle

Lytic VS Lysogenic Cycle

Ways to Protect l l l Vaccinations: weakened or dead viruses injected into the body to stimulate immune response. (Antibodies form against virus) Proper hygiene/hand washing Minimize risk by avoiding risky behavior. (ex. IV drug use, unprotected sex)

Cancer l Some viruses have been linked to the formation of tumors. – HPV linked to cervical cancer – Hepatitis B and C linked to liver cancer – Epstein-Barr linked to lymphoma