DNA Fingerprinting DNA Extraction DNA can be extracted

DNA Fingerprinting

DNA Extraction: DNA can be extracted from almost any human tissue. • Buccal cells from inside cheek for paternity tests. • Sources of DNA at crime scene: blood, semen, hair follicle, saliva. • DNA extracted from evidence is compared to DNA from known individuals

• Extracted DNA molecules are incubated with restriction enzymes (endonucleases). ØRestriction enzymes are produced by bacteria as a defense against viruses. ØThese enzymes cut DNA at specific base sequences called recognition sites. ØResults in smaller pieces of DNA called RFLP’s.

An Eco. R 1 restriction enzyme

RFLP Analysis: • RF stands for Restriction Fragments. Those are the fragments that were cut by restriction enzymes. • L stands for Length, and refers to the length of the restriction fragment. • P stands for Polymorphisms, a Greek term for “many shapes”. The lengths of some of the restriction fragments differ greatly between individuals. RFLP = Restriction Fragment Length Polymorphism

Electrophoresis of these RFLP’s produce different patterns of DNA bands. With 3 billion base pairs in the human genome, however, RFLP analysis would produce a ‘smear’ of many similar sized fragments. Molecular biologists have identified regions of the human genome where restriction fragment lengths are highly variable between individuals.

VNTR alleles are highly variable regions of human DNA. • VNTR stands for ‘variable number of tandem repeats. • A tandem repeat is a short sequence of DNA that is repeated at a specific chromosomal locus. • Tandem repeats are interspersed throughout the human genome.

VNTR’s continued: • The number of repeats at a given place on a certain chromosome is highly variable from one person to another. • The number of such repeats is usually different on the paternal and maternal members of the same person’s chromosome pair.

Red boxes represent the repeat unit and the blue lollipops represent cut sites for a restriction endonuclease. (Here 3 different variants, may be 50 in reality).

• Analysis of a VNTR locus most commonly results in a two-band pattern, one band inherited from each parent. • A one-band pattern can occur if the size of the two parental bands are the same or nearly the same. • For our simple example of three different alleles designated A, B, and C illustrated above, six unique DNA profiles are possible.

The possible genotypes are AA, BB, CC, AB, BC, and AC

RFLP Analysis: • The RFLP markers most commonly used for DNA profile analysis are found on chromosomes 1, 2, 4, 5, 10 and 17. • These RFLP markers are named after their locations on these chromosomes. • • For example, the marker on chromosome 2 is called D 2 S 44 (section 44 of chromosome 2). • These chromosomal locations are also referred to as DNA loci.

• The Federal Bureau of Investigation (FBI) has been a leader in developing DNA typing technology for use in the identification of perpetrators of violent crime. • In 1997, the FBI announced the selection of 13 STR (short tandem repeat) loci to constitute the core of the United States national database, CODIS. • All CODIS STRs are tetrameric repeat sequences. • All forensic laboratories that use the CODIS system can contribute to a national database.

• For example, D 7 S 280 is one of the 13 core CODIS STR genetic loci. This DNA is found on human chromosome 7. • The tetrameric repeat sequence of D 7 S 280 is "gata". Different alleles of this locus have from 6 to 15 tandem repeats of the "gata" sequence.

How many tetrameric repeats are present in the DNA sequence shown below? Notice that one of the tetrameric sequences is "gaca", rather than "gata". 1 aatttttgta ttttag agacggggtt tcaccatgtt ggtcaggctg actatggagt 61 tattttaagg ttaatatata taaagggtat gatagaacac ttgtcatagt ttagaacgaa 121 ctaacgatagatagatagatagacagat 181 agatagtttttatctc actaaatagt ctatagtaaa catttaatta ccaatatttg 241 gtgcaattct gtcaatgagg ataaatgtgg aatcgttata attcttaaga atattc 301 cctctgagtt tttgatacct cagattttaa ggcc

DNA profiles vary from person to person. • When profiles from a single VNTR locus from unrelated individuals are compared, the profiles are normally different. • However, it is possible for two individuals to have the same profile at one or two loci. • But the chance of more than one person having the same DNA profile at 4, 5, or 6 different VNTR loci is extremely small.

DNA primers have been optimized to allow amplification of multiple STR loci in a single reaction mixture.

Norma’s genotype is 15, 15 at the locus D 3 S 1358, 14, 16 at v. WA, and 24, 25 at FGA.

A DNA Profile: The 13 CODIS STR loci Locus D 3 S 1358 v. WA FGA D 8 S 1179 Genotype 15, 18 16, 16 19, 24 12, 13 29, 31 12, 13 11, 13 Frequency 8. 2% 4. 4% 1. 7% 9. 9% 2. 3% 4. 3% 13% D 21 S 11 D 18 S 51 D 5 S 818 Locus D 13 S 317 D 7 S 820 D 16 S 539 THO 1 TPOX CSF 1 P O AMEL Genotype Frequency 11, 11 10, 10 11, 11 9, 9. 3 8, 8 11, 11 XY 1. 2% 6. 3% 9. 5% 9. 6% 3. 52% 7. 2% Male

How common or rare would this 13 locus DNA profile be in the reference population? In most cases, a "product rule" calculation can be done by multiplying each individual probability together By combining the frequency information for all 13 CODIS loci, this frequency of this profile would be 1 in 7. 7 quadrillion Caucasians…that’s 1 in 7. 7 x 1015 power!