DNA By Mr Kauffman Outline DNA background information
DNA By: Mr. Kauffman
Outline • • • DNA background information Discovering DNA structure How DNA works Storing DNA
DNA Background Information • DNA: Deoxyribonucleic Acid • DNA is the genetic/hereditary material found in all cells – Stored in the nucleus – Contains the information that determines what we look like
DNA Background Information • Contains the information to control a cell’s growth and function, but… – Only tells how to make things – Other parts (proteins) of the cells actually do the work
DNA Background Information • DNA Analogy – DNA is like a cookbook – It tells how to make something, but it doesn’t actually make it • Your DNA contains the instructions for how to make you
DNA Background Information • Every “normal” cell in your body has the same exact DNA in it – Skin and muscle cells are normal cells • When a cell divides, the DNA inside the cell is copied and each new cell gets 1 copy of it
Discovering DNA • Scientists have known about DNA since the 1800’s • 1952 – Rosalind Franklin discovered that DNA was made up of 2 chains in a spiral shape • 1953 – James Watson and Francis Crick made a model of DNA
DNA Structure • Known as a Double Helix – Meaning there are 2 sides in a spiral shape – More commonly called a twisted ladder
DNA Structure • Outer parts of the DNA ladder are called the sugar-phosphate backbone – Alternating sections of sugar and phosphate
DNA Structure • The inside (rungs) of the DNA ladder are made up of nitrogen bases – There are 4 types of nitrogen bases 1. 2. 3. 4. Adenine (A) Cytosine (C) Guanine (G) Thymine (T) – The bases are always found in pairs • Adenine (A) always pairs with Thymine (T) • Cytosine (C) always pairs with Guanine (G) • They fit together like puzzle pieces
DNA structure
DNA structure C A G C T • Draw the picture on the left in your notes • Provide the base that each base you have been given would pair with
How DNA works • The sequence of the DNA bases (A, C, G, T) determines the information contained in the DNA – A sequence of 3 bases is called a codon • ACGGCAATTGCTTTTAAGCCA • ACG , GCA , ATT , GCT , TTT, AAG , CCA
20 Amino Acids Amino Acid DNA Codon Isoleucine ATT, ATC, ATA Serine TCT, TCC, TCA, TCG, AGT, AGC Leucine CTT, CTC, CTA, CTG, TTA, TTG Tyrosine TAT, TAC Valine GTT, GTC, GTA, GTG Tryptophan TGG Phenylalanine TTT, TTC Glutamine CAA, CAG Methionine ATG Asparagine AAT, ACC Cysteine TGT, TGC Histidine CAT, CAC Alanine GCT, GCC, GCA, GCG Glutamic Acid GAA, GAG Glycine GGT, GGC, GGA, GGG Aspartic Acid GAT, GAC Proline CCT, CCC, CCA, CCG Lysine AAA, AAG Threonine ACT, ACC, ACA, ACG Arginine CGT, CGC, CGA, CGG, AGA, AGG
Storing DNA • DNA is stored in the nucleus of the cell – Stored as chromosomes • How many chromosomes do humans have? – Every “normal” human cell has 46 single chromosomes, or 23 pairs of chromosomes – Each chromosome contains DNA with different information in it
Storing DNA Human Chromosome Chart
Storing DNA Actual Human Chromosomes
- Slides: 17