DNA Analysis Bellringer Take out your review sheet
DNA Analysis
Bellringer Take out your review sheet from yesterday.
Objectives Introduction to the characteristics of DNA and DNA analysis.
Quiz on Friday Study your review sheet
DNA “fingerprinting” is a common way to identify people by their unique genetic code DNA “profiling” is a better way to refer to the process; it has nothing to do with fingers or fingerprints.
DNA Where can you find DNA? DNA is in every nucleated cell of the human body and can be extracted from blood, semen, urine, bone, hair follicles, and saliva.
DNA What types of crimes does DNA evidence help solve? DNA is currently being used to identify the perpetrator in a crime, to identify fathers in paternity cases, and to identify unknown remains.
Aspects of DNA In the nucleus of cells are chromosomes that are inherited from both parents. Chromosomes are long-chain DNA molecules that are tightly bound in a specific structure. DNA (deoxyribonucleic acid) is the hereditary material of most organisms. Held together by hydrogen bonds
Chromosomes
Chromosomes
Fun Fact If all of the DNA in your body was stretched out and put end to end, it would reach to the sun and back more than 600 times!
DNA The human body has approximately 35, 000 genes Genes are simply portions of the DNA that code the information required to make specific proteins. Proteins determine human traits and functions.
Genes Each gene has a specific code for a specific body function; they are the fundamental unit of heredity, determining traits from hair color, eye color, and facial features to certain diseases or disorders.
Human Genome Project Began in 1990 Set out to identify all of the genes of humans, and the order they are in. We did it.
DNA Structure The structure of DNA is important to its function. An unusual property of DNA is its ability to replicate itself. It is arranged in a right-handed double helix pattern. Twisted ladder
DNA Structure The sides of the helix are the sugar and phosphates groups (acidic properties) On the inside are the base pairs. Ladder rungs The average DNA molecule contains 100 million nucleotide groups.
DNA Structure The order of these pairs is 99. 9 percent the same for everyone.
DNA Genes are different amounts of base pairs (1, 000 to several hundred thousand) A chromosome is a single DNA molecule twisted and packed into the nucleus of the cell. The sequence of the nucleotide bases is what determines the proteins that will lead to specific growth, function, and reproduction.
Twins Identical twins share 100 percent identical DNA. Fraternal twins share only 50 percent of their DNA, just like regular siblings. This makes for some twists in crimes!
How you get your DNA
Checkpoint What are chromosomes? How is DNA like a fingerprint?
Forensic Uses of DNA Read pages 340 to 345 in the textbook and answer the following questions: 1. How and when was the first criminal case to use DNA evidence? 2. What type of blood cell contains DNA? 3. How many nuclei are in a single drop of blood? 4. Name 4 uses of DNA profiling 5. What is used to release DNA from the chromosome? 6. What are the four main procedures involved in DNA fingerprinting?
Answers 1. Blood samples were taken for DNA testing in 1986. 2. White blood cells contain DNA because they have a nucleus. 3. A single drop of blood contains between 7, 000 to 25, 000 nuclei. 4. Clearing the wrongly accused, identifying victims, establishing family relationships, and identify suspects. 5. Enzymes are used to release DNA from the chromosomes. 6. Isolation, Cutting, Sorting, and Analyzing.
Bellringer Where is DNA located in the body?
Objective Learn how forensic scientist extract DNA from a chromosome
Answers 1. Blood samples were taken for DNA testing in 1986. 2. White blood cells contain DNA because they have a nucleus. 3. A single drop of blood contains between 7, 000 to 25, 000 nuclei. 4. Clearing the wrongly accused, identifying victims, establishing family relationships, and identify suspects. 5. Enzymes are used to release DNA from the chromosomes. 6. Isolation, Cutting, Sorting, and Analyzing.
DNA The base pairs of DNA only have two possibilities 1. Adenine –Thymine 2. Guanine-Cytosine Written as A, T, G, & C for short.
Statistical Analysis in DNA Profiling The DNA molecule is hundreds of thousands of base pairs long. Break the DNA molecule at certain points to form fragments. Then compare the size and amount of fragments. 1 in 5 million chance of someone else sharing your profile
RFLP Analysis R-Restriction enzymes are used to cut the DNA into F-Fragments that are many different L=Lengths and exhibit P-Polymorphism, which means many shapes. The length of these fragments varies greatly among individuals
RFLP Analysis A DNA sample is placed in a special tank that has an electric charge going across it. An enzyme is added to the tank the cuts the DNA at specific spots. The different lengths of DNA then move across the tank at different speeds depending on their length.
RFLP Analysis
Checkpoint 1. What are the two possible base pairs of DNA? 2. What does RFLP stand for?
Bellringer How does RFLP analysis work, and why is it done?
Objectives Finish RFLP testing activity Know when to use each of the four main DNA analysis techniques.
Movies
Simulation of RFLP –pg 346 Use a meter stick to mark off every 2. 5 cm on your strip of paper, and then draw a long line all the way down the center. In every 2. 5 cm box write four letters in any order, and in any combination that you want (A, T, G, C). After you filled in the top, fill in the bottom with the complementary letter below.
Simulation of RFLP –pg 346 Make cuts at the A-T boundary Then measure each of the fragments with a ruler; record the length on the back of each strip Make the same chart as the in the TB and fill in the first column with your data. Bring your data to me once you’re done.
Simulation of RFLP –pg 346 Length 1 2 3 4 5 6 7 8 9 1320 cm 1 5 3 3 2 3 1 3 5 9 -13 cm 2 2 2 4 5 2 3 4 4 6 -9 cm 0 0 4 4 7 4 6 3 1 4 -6 cm 3 0 5 4 2 2 2 -4 cm 2 4 5 3 2 3 8 4 2 0 -2 cm 1 1 5 2 2 1 8 9 0
Simulation of RFLP A DNA sample found at the scene of the crime with the following RFLP data came back from the lab…whose is it? Length ? 1320 cm 4 9 -13 cm 4 6 -9 cm 2 4 -6 cm 3 2 -4 cm 6 0 -2 cm 10
Polymerase Chain Reaction PCR is a lab technique used to “copy and paste” a very small DNA sample Need 50 percent less DNA than what is required for a RFLP test.
PCR Forensic scientists cut the DNA sample long ways, breaking the weak hydrogen bonds Since the base pairs only bond in specific pairs, single bases are added and they automatically attach themselves in the cut DNA sample in the correct order. This process is then repeated until there is enough DNA to complete a RFLP test
PCR Example DNA sample found at crime, but too small to test ATGC ACGT TATT GCTA ACTG TCGA CGAG CAAT CGCA TGCT TACG TGCA ATAA CGAT TGAC AGCT GCAC GTTA GCGT ACGA ACTGCTACGATGCATGCATCAGTCGATGCAGCTGATG CATGCTGATGCTAGCTGATCGTAGCTGACTGATCGTAGC ATGC ACGT TATT GCTA ACTG TCGA CGAG CAAT CGCA TGCT TGACGATCGTAGCTCGACTGATCGTAGCTAGCTGAC TACG TGCA ATAA CGAT TGAC AGCT GCAC GTTA GCGT ACGA GAGACGTAGCTGATGCAGCTGATCGTAGCTCGACGAGCATCGAGCA TG ATGC ACGT TATT GCTA ACTG TCGA CGAG CAAT CGCA TGCT TACG TGCA ATAA CGAT TGAC AGCT GCAC GTTA GCGT ACGA
PCR After one split they have 2 times the original DNA After two splits they have 4 times the original DNA After three splits they have 8 times the original DNA After ten splits they have 1024 times the original DNA
Checkpoint What is the point of PCR testing? How is PCR different RFLP?
Bellringer
Objectives
Updates Movies Entomology Tests
Short Tandem Repeats New technique that is becoming more common than RFLP because it takes less time, less of a sample size, and is more exclusionary. STRs are locations on the chromosome that repeats a specific sequence of two to ten base pairs.
STR Thousands of STR sites have been identified They are located on almost every chromosome in the body Easily amplified using PCR
STR Forensic scientists scan 13 DNA regions that vary from person to person They use the data to create a DNA profile of that individual There is an extremely small chance that another person has the same DNA profile for a particular set of regions
STR analysis is now the primary method for genetic profiling In 1992 the Innocence Project at the Cardozo School of Law started using STR tests to free wrongfully convicted people from jail. As of January 7 th, 2014 312 have been exonerated As of May 29 th , 2014 316 have been exonerated
Checkpoint Why is STP more widely used today than RFLP?
Mitochondrial DNA Mitochondria is the powerhouse of the cell, providing 90 percent of the energy a human needs to function Each cell contains thousands of mitochondria, each containing several loops of DNA with 15, 000 -17, 00 base pairs. Unlike nuclear DNA, which if found on the chromosomes, mitochondrial DNA (mt. DNA) is inherited only from the mother.
Mt. DNA Usually no change in mt. DNA from mother to offspring Individuals with the same maternal lineage are indistinguishable if mt. DNA is used for analysis You, your siblings, your Mom’s siblings, your Grandma’s siblings, your Great Grandma siblings, and so on all share the same mt. DNA!
Mt. DNA Analysis techniques are more sensitive than other profiling techniques, more costly, and takes more time. Cases in which hairs, bones, or teeth are the only evidence retrieved from a crime scene are particularly well-suited to mt. DNA analysis.
Checkpoint When is Mt. DNA most commonly used? How much does Mt. DNA change from mother to child? When should you use RFLP, PCR, STR, and Mt. DNA analysis?
Example A very small sample of DNA is found at the scene of a murder. You want to know whose it is. What DNA test(s) should you carry out to process the sample?
Fake DNA Is it possible to fake your DNA results? Dentist raped his patient when she was sedated. He installed a drain in his body with someone else’s blood. This way the DNA from his blood test wouldn’t match the DNA recovered from the woman.
Old Evidence On pages 362 read the story in the blue box, then on page 363 read the case study. 1. How are these two stories similar? 2. How does DNA analysis help solve crimes by using old evidence? 3. Why is it important to build up data bases, and save evidence even after crimes have been cold for years?
Simulation of RFLP –pg 346 Use a meter stick to mark off every 2. 5 cm on your strip of paper, and then draw a long line all the way down the center. In every 2. 5 cm box write four letters in any order, and in any combination that you want (A, T, G, C). After you filled in the top, fill in the bottom with the complementary letter below.
Bellringer What does RFLP stand for?
Objectives Finish our simulated RFLP DNA test. Textbook questions Notes on other DNA analysis
Simulation of RFLP –pg 346 Going left to right make a cut on the top strand at every AT sequence Going right to left make a cut on the bottom strand at every AT sequence Measure each of the fragments with your meter stick and write the length on the back. Fill in the chart, and get data from at least 8 other pairs
Simulation of RFLP –pg 346 Length 1 2 3 4 5 6 7 1320 cm 4 3 2 2 4 4 0 9 -13 cm 4 2 3 1 2 3 2 6 -9 cm 2 2 1 4 2 2 2 4 -6 cm 3 0 3 8 5 3 14 2 -4 cm 6 1 3 7 4 3 10 0 -2 cm 10 4 1 10 1 3 10 8 9
Simulation of RFLP Length A DNA sample found at the scene of the crime with the following RFLP data came back from the lab…whose is it? 1320 cm 9 -13 cm 6 -9 cm 4 -6 cm 2 -4 cm 0 -2 cm ?
Forensic Uses of DNA Read pages 340 to 345 in the textbook and answer the following questions: 1. How and when was the first criminal case to use DNA evidence? 2. What type of blood cell contains DNA? 3. How many nuclei are in a single drop of blood? 4. Name 4 uses of DNA profiling 5. What is used to release DNA from the chromosome? 6. What are the four main procedures involved in DNA fingerprinting?
Bellringer What is a RFLP DNA test?
Objectives Learn about other DNA analysis techniques besides RFLP Bring laptops tomorrow if you don’t want to use the schools
Statistical Analysis in DNA Profiling The DNA molecule is hundreds of thousands of base pairs long. If you look at only a fragment of the DNA, what are the chances of someone else having the same size fragment? 1 in 5 million chance of someone else sharing your profile
Polymerase Chain Reaction PCR is a lab technique used to “copy and paste” a very small DNA sample Need 50 percent less DNA than what is required for a RFLP test.
PCR Forensic scientists cut the DNA sample long ways, breaking the weak hydrogen bonds Since the base pairs only bond in specific pairs, single bases are added and they automatically attach themselves in the cut DNA sample in the correct order. This process is then repeated until there is enough DNA to complete a RFLP test
PCR Example DNA sample found at crime, but too small to test ATGC ACGT TATT GCTA ACTG TCGA CGAG CAAT CGCA TGCT TACG TGCA ATAA CGAT TGAC AGCT GCAC GTTA GCGT ACGA ACTGCTACGATGCATGCATCAGTCGATGCAGCTGATG CATGCTGATGCTAGCTGATCGTAGCTGACTGATCGTAGC ATGC ACGT TATT GCTA ACTG TCGA CGAG CAAT CGCA TGCT TGACGATCGTAGCTCGACTGATCGTAGCTAGCTGAC TACG TGCA ATAA CGAT TGAC AGCT GCAC GTTA GCGT ACGA GAGACGTAGCTGATGCAGCTGATCGTAGCTCGACGAGCATCGAGCA TG ATGC ACGT TATT GCTA ACTG TCGA CGAG CAAT CGCA TGCT TACG TGCA ATAA CGAT TGAC AGCT GCAC GTTA GCGT ACGA
PCR After one split they have 2 times the original DNA After two splits they have 4 times the original DNA After three splits they have 8 times the original DNA After ten splits they have 1024 times the original DNA
Bellringer What is the purpose if PCR DNA analysis?
Objectives Learn about STR, mt. DNA, and fake DNA samples. We’ll be working on the school laptops on Monday, so if you remember bring yours in if you can.
NEOTWY’s Who would like to share their NEOTWY for this week? Please pass up your NEOTWY’s
Short Tandem Repeats New technique that is becoming more common than RFLP because it takes less time, less of a sample size, and is more exclusionary. STRs are locations on the chromosome that repeats a specific sequence of two to ten base pairs.
STR Thousands of STR sites have been identified They are located on almost every chromosome in the body Easily amplified using PCR
STR Forensic scientists scan 13 DNA regions that vary from person to person They use the data to create a DNA profile of that individual There is an extremely small chance that another person has the same DNA profile for a particular set of regions
STR analysis is now the primary method for genetic profiling In 1992 the Innocence Project at the Cardozo School of Law started using STR tests to free wrongfully convicted people from jail. As of January 7 th, 2014 312 have been exonerated
Checkpoint How can PCR tests help forensic scientists analyze DNA evidence? What is the most common method of genetic profiling?
Mitochondrial DNA Mitochondria is the powerhouse of the cell, providing 90 percent of the energy a human needs to function Each cell contains thousands of mitochondria, each containing several loops of DNA with 15, 000 -17, 00 base pairs. Unlike nuclear DNA, which if found on the chromosomes, mitochondrial DNA (mt. DNA) is inherited only from the mother.
Mt. DNA Usually no change in mt. DNA from mother to offspring Individuals with the same maternal lineage are indistinguishable if mt. DNA is used for analysis You, your siblings, your Mom’s siblings, your Grandma’s siblings, your Great Grandma siblings, and so on all share the same mt. DNA!
Mt. DNA Analysis techniques are more sensitive than other profiling techniques, more costly, and takes more time. Cases in which hairs, bones, or teeth are the only evidence retrieved from a crime scene are particularly well-suited to mt. DNA analysis.
Fake DNA Is it possible to fake your DNA results? Dentist raped his patient when she was sedated. He installed a drain in his body with someone else’s blood. This way the DNA from his blood test wouldn’t match the DNA recovered from the woman.
Fake DNA The Phantom of Heilbronn A string of killings between 1993 and 2009 all had the same DNA evidence, but were in Austria, France and Germany, and had no other connections. The cotton swabs the detectives used to collect DNA samples already had DNA on them from someone in the factory that made the cotton swabs.
Old Evidence On pages 362 read the story in the blue box, then on page 363 read the case study. 1. How are these two stories similar? 2. How does DNA analysis help solve crimes by using old evidence? 3. Why is it important to build up data bases, and save evidence even after crimes have been cold for years?
Bellringer What is the difference between RFLP, PCR, and STR testing?
Objective Practice applying your knowledge of DNA and DNA analysis while learning about the history and issues of DNA evidence.
Laptop Activity Grab a partner and a laptop Go to my page on the Windsor School website http: //www. windsor-csd. org/Mr. VERSPOOR. aspx Click “Forensics” Download the Power. Point labeled “Student Copy – DNA Analysis” Follow the Power. Point, and answer the questions.
DNA Timeline http: //www. dnai. org/timeline/index. html Go through the timeline and answer the following questions: 1. What did Friedrich Miescher do? 2. Who discovered the double helix pattern of DNA? 3. What did Craig Venter do?
DNA Fingerprinting http: //www. pbs. org/wgbh/nova/education/body/creat e-dna-fingerprint. html Follow the link above and click view. Preform the RFLP test. Record the exact steps needed to fully develop DNA fingerprints Who was guilty?
The Innocence Project http: //www. innocenceproject. org/ Follow the link above, and answer the following questions: What is “The Innocence Project” What is a false confession, how often do they occur, and why do they occur? What is “Forensic Science Misconduct”, and what are the two most common types of it? Why is eyewitness evidence not as reliable as DNA evidence? How can bad lawyering lead to a false conviction?
- Slides: 95