DEVELOPMENT OF APTAMER BASED LATERAL FLOW IMMUNOCHROMATOGRAPHY STRIP

DEVELOPMENT OF APTAMER BASED LATERAL FLOW IMMUNOCHROMATOGRAPHY STRIP TEST FOR HALAL AUTHENTICATION OF PHARMACEUTICAL PRODUCTS CONTAIN GELATIN Hari Widada 1, 2, Abdul Rohman 2, Ririrs Istifgfarie Jenie 2, Sismindari 2 School of Pharmacy, Faculty of Medical and Health Sciences Universitas Muhammadiyah Yogyakarta, Indonesia 1 Doctoral Programme, Faculty of Pharmacy, Universitas Gadjah Mada, Yogyakarta, Indonesia 2 sismindari@ugm. ac. id ABSTRACT The development of non-halal component detection technology is important because there are many cases of mixing non-halal ingredients with halal ingredients. The halal contaminant detection tool that can be applied in the field quickly, efficiently, portable and can be used for large amounts of samples such as the current strip test is still limited and must be imported from abroad. This study aims to develop rapid detection of halal contaminants in food and pharmaceutical products with apatamer-based lateral flow immunochromatography (single-strand oligonucleotides / ss. DNA). The principle of making immunochromatographic test strips is to conjugate colloidal gold as a marker with aptamer. This conjugate is placed on the conjugate pad, one part of the immunochromatographic strip test system. Analysis of food/ pharmaceutical products with immunochromatographic test strips using samples made with gelatin, both references from bovine, porcine, vegetable gelatin and a mixture of gelatin from bovineporcine and vegetable-porcine and also pharmaceutical products in the form of capsules on the market. The results of this research up to this stage have been obtained by the oligonucleotide sequence (ss. DNA aptamer) which will be used to design the LFI test strip. One of the sequences is as follows: 5 '-GCCTAAAATCTCCCCTCCATGGATATGCCTAAATCTTCCCTCAATGGTATGGCTAAATCTCCCCCGTAAGGCTAAA-TCTTCCTT-3'. Furthermore, aptamer candidates who will be used as biosensors will be purchased from suppliers in the modified position 5 'so that it can be applied in the LFI strip test system. Keywords: Lateral Flow Strip Test, Aptamer, porcine gelatin Methods Introduction A good technique must be supported by adequate laboratory equipment, so that it can detect counterfeiting and differentiate mixtures which are critical points in the authentication of halal products. Molecular biologybased methods, such as polymerase chain reaction (PCR), Real-Time PCR (Rodriguez et al. , 2005), Restriction Fragment Length Polymorphism (RFLP) analysis (Chen et al. , 2010), multiplex PCR (Ghovvati et al. , 2009), and speciesspecific PCR (Man et al. , 2007). Another method developed for the detection of components from pigs in food is a DNA-based method by exploring aptamer specific to selected porcine gelatin using the SELEX (Systematic Evolution of Ligands by Exponential Enrichment) method. This research will develop rapid detection devices in the form of strip tests with the target of porcine gelatin in pharmaceutical products with aptamer as biosensor. Materials HAu. Cl 4· 3 H 2 O, Tris (2 -carboxyethyl) phosphine (TCEP), bovine serum albumin (BSA), ovalbumin (OVA), DTT and streptavidin were provided by Sigma-Aldrich (St. Louis, MO, USA). Sodium hydrogen phosphate (Na 2 HPO 4), monobasic potassium (KH 2 PO 4), sodium chloride (Na. Cl), potassium chloride (KCl) and other reagents were from Beijing Chemical works (Beijing, China). Ethyl acetate (HPLC grade) was purchased from Fisher Scientific (Fisher Scientific, Fair Lawn, NJ, USA). Water was obtained from a Milli Q purification system (Millipore). All other inorganic chemicals and organic solvents were of analytical grade or better. purchased from Sigma Aldrich. Aptamer 5’-GCCTAAATCTCCCCTCAAT GGTATGCCTAAATCTTCCCTCAATGGTATGG CTAAATCTCCCCCCGAAAATCTAT TTGCCTCTTTCATTTTTTTTTTT-SH-3’, probe-1 5’-ATGAAAGAGGC AAATAGATTTTCGGGGGGAGATTTAGCCATACCATT GAGGGAAGATTTAGG CATATTGAGGGGAGATTTAGGC-Biotin-3’ and probe-2 5’-ATGAAAGAGGC AAATAG ATTTTCG GGGGGAGATTTAGCCATACC ATTGAGGGAAGATTTAGG CATATTGATATT GAGGGGAGATTTAGGC-Biotin-3’ were purchased form IDT (USA). Acknowledgements This Projects supported by Ministry of Research, Technology and Higher Education of the Republic of Indonesia contributed to this study. Reference Preparation of Aptamer. Au. NPs Conjugate • Conjugation Au. NPs with SHAptamer • Optimization by adding DTT • Using streptavidinbiotin raction • Consist of DNA probe 1&2 Preparation od Test Line & Control Line Design of Lateral Flow Strip Test Results and Discussion Figure 2. Sequencing results of aptamer candidate for biosensor No Figure 1. SELEX procedure modifierd by adding graphene oxide (GO) CP: Hari Widada School of Pharmacy, Universitas Muhammadiyah Yogyakarta, Indonesia. Email: hr. widada@gmail. com • Au. NPs diameter’s is 10 nm • HAu. Cl 4. 3 H 2 O 1% + Na-Sitrat 1% 1. Preparation of Gold Nanoparticles Name Spesification 1 Conjugate SHAptamer 5’- GCC TAA ATC TCC CCT CAA TGG TAT GCC TAA ATC TTC CCT CAA GG TAT GGC TAA ATC TCC CGA AAA TCT ATT TGC CTC TTT CAT TTT TTT TTT TT-SH-3’ 2 Probe-1 5’-ATG AAA GAG GCA AAT AGA TTT TCG GGA GAT TTA GCC ATA CCA TTG AGG GAA GAT TTA GGC ATA TTG AGG GGA GAT TTA GGC-Biotin-3’ 3 Probe-2 5’-AAA AAA AAA AA-Biotin-3’ Conclusion Aptamer can be selected by the GO-SELEX method by using a target of pig gelatin. Selected aptamers have the potential to be designed as biosensors for lateral flow strip test models. Chen, S. -Y. , Liu, Y. -P. , Yao, Y. -G. , 2010, Species authentication of commercial beef jerky based on PCR–RFLP analysis of the mitochondrial 12 S r. RNA gene. Journal of Genetics and Genomics 37 (11), 763– 769 Ghovvati, S. , Nassiri, M. R. , Mirhoseini, S. , Moussavi, A. H. , Javadmanesh, A. , 2009, Fraud identification in industrial meat products by multiplex PCR assay. Food Control 20 (8), 696– 699 Man, Y. B. C. , Aida, A. A. , Raha, A. R. , Son, R. , 2007. Identification of pork derivatives in food products by species–specific polymerase chain reaction (PCR) for halal. Food Control 18 (7), 885– 889