CS 5263 Bioinformatics Lecture 7 Heuristic Sequence Alignment

CS 5263 Bioinformatics Lecture 7: Heuristic Sequence Alignment Algorithms (BLAST)

Roadmap • Last lecture review – Sequence alignment statistics • Today – Gene finding by alignment – Heuristic alignment algorithms • Basic Local Alignment Search Tools

Sequence Alignment Statistics • Substitution matrices – How is the BLOSUM matrix made – How to make your own substitution matrix – What’s the meaning of an arbitrary substitution matrix • Significance of sequence alignments – P-value estimation for • Global alignment scores • Local alignment scores

What is a p-value? • The probability of observing an effect as strong or stronger than you observed, given the null hypothesis. i. e. , “How likely is this effect to occur by chance? ” • Pr(x > S | null)

What is a null-hypothesis? • A statistician’s way of characterizing “chance. ” • Generally, a mathematical model of randomness with respect to a particular set of observations. • The purpose of most statistical tests is to determine whether the observed data can be explained by the null hypothesis.

For sequence alignment • Your null hypothesis is “the two sequences are unrelated” • Your alternative hypothesis is “the two sequences are related” • You obtained a score S – how likely that you can obtain such a score if the null hypothesis is true?

How to test that null-hypothesis? • Randomly generate some pairs of “unrelated” sequences • See what alignment scores you may get for those “unrelated” sequences • Must keep other factors in mind – Your random sequences must be as close as possible to your true sequences – Except that they are “unrelated” (i. e. , not from a common ancestor)

Possible ways to get unrelated sequences • Which is better? – Randomly pick some sequences from a database and truncate to the same length as your real sequences – Generate random sequences according to the frequency that each letter is used by your real sequences – Randomly shuffle your sequences

Possible ways to get random sequences • Which is better? – Randomly pick some sequences from a database and truncate to the same length as your real sequences – Generate random sequences according to the frequency that each letter is used by your real sequences – Randomly shuffle your sequences

• Random shuffling is what we do to estimate p-values for global alignment

Mouse HEXA Human HEXA Score = 732 …………………………

732 Distribution of the alignment scores between mouse HEXA and 200 randomly shuffled human HEXA sequences P-value: less than 1/200 = 0. 005

• Advantages – Easy to implement – You don’t need to know a lot of theories to do this • Disadvantages – Slow – Cannot estimate small p-values – If we had repeated 1, 000 times, would we get a score as high 732? • Based on what I’ve already seen, I would guess probably no • What about 1, 000 times?

When theory exists • It gets much better • You don’t really need to go there to know what’s there • (I know roughly how many times you can get a score as high as 732 if you repeat your experiments a billion times…) • That is what happened for local alignment

• For ungapped alignment between two sequences of lengths M and N E(S) = KMN exp[- S] (Expected value, E-value. ) • K, depends on sequence composition and substitution matrix – Can be obtained either empirically or analytically

when P is small.

Extreme value distribution Theory says my score distribution should have this shape Distribution of alignment scores for 1000 random sequence pairs My experiment shows me that theory seems correct

Example • You are aligning two sequences, each has 1000 bases • m = 1, s = -1, d = -inf (ungapped alignment) • You obtain a score 20 • Is this score significant?

• • • = ln 3 = 1. 1 E(S) = K MN exp{- S} E(20) = 0. 1 * 1000 * 3 -20 = 3 x 10 -5 P-value = 3 x 10 -5 << 0. 05 The alignment is significant

20 Distribution of 1000 random sequence pairs

Multiple-testing problem • You are searching a 1000 -base sequence against a database of 106 sequences (average length 1000 bases) • You get a score 20 • You are essentially comparing 1000 bases with 1000 x 106 = 109 bases (ignore edge effect) • E(20) = 0. 1 * 1000 * 109 * 3 -20 = 30 • By chance we would expect to see 30 matches • P-value = 1 – e-30 = 0. 99999 • Not significant at all

A better way to understand p-value • Your p-value is 0. 99999 • You have very low confidence (<0. 00001) to say that the null hypothesis is wrong • Is the null hypothesis true then (i. e. , the two sequences are unrelated)? – You don’t know – Your test was not designed to tell you that

In practice • You search the sequence against a database of 106 sequences • You get 35 matches • You expect to get about 30 by chance • It could be all 35 are real, or none, or some • You already reduced your target from 106 sequences to 35 sequences • Take all 35 sequences with caution. Look for other evidences

Statistics for gapped local alignment • Theory not well developed • Extreme value distribution works well empirically • Need to estimate K and empirically

Exercising FSA • How do you make an FSA for the Needleman-Wunsch algorithm?

Exercising FSA • How do you make an FSA for the Needleman-Wunsch algorithm? (-, yj)/d (xi, yj) / Ix (-, yj) / d (xi, yj) / (xi, -)/d (-, yj) / d F (xi, -) / d (xi, yj) / Iy (xi, -)/d

Simplify (xi, yj) / (xi, -) / d F (xi, yj) / (-, yj) / d (xi, -) / d I (-, yj) / d

Simplify more (xi, yj) / F(i-1, j-1) + (xi, yj) F(i, j) = max F(i-1, j) + d F(i, j-1) + d F (xi, -) / d (-, yj) / d

A more difficult alignment problem • (A gene finder indeed!) • X is a genomic sequence (DNA) – X encodes a gene – May contain introns • Y is an ORF from another species – Contains only exons • We want to compare X against Y – Conservation is on the level of amino acids

DNA intron Pre-m. RNA 5’ UTR exon 3’ UTR Splice Mature m. RNA (m. RNA) Open reading frame (ORF) Start codon Stop codon

• We have a predicted gene • We know the positions of the start codon and stop codon • But we don’t know where are the splicing sites – Not even the number of introns intron Start codon exon intron exon Stop codon

1. Most splicing sites start at GT and end at AG 2. But there are lots of GT and AG in the sequence 3. Aligning to a orthologous gene with known ORF may help us determine the splicing sites • Orthologous genes: two genes evolved from the same ancestor • Coding region are likely conserved on amino acid level • UUA, UUG encode the same amino acid • So do UCA, UCU, UCG, UCC GT…………AG Mouse putative gene human ORF

The Genetic Code Third letter

If know where are the exons • Easy Mouse putative gene Remove introns Mouse putative ORF translate Global alignment human ORF translate

Or directly align triplets Mouse putative gene Remove introns Mouse putative ORF Global alignment human ORF

Codon substitution scores AAA AAG AAU AAC AAA 4 3 -1 AAG 3 4 AAU -1 AAC … … … UCU UCC -1 -1 4 3 1 1 -1 -1 3 4 1 1 UCU -1 -1 1 1 4 3 UCC -1 -1 1 1 3 4 … … … 64 x 64 substitution matrix

FSA for aligning genomic DNA to ORF (xi-2 xi-1 xi, yj-2 yj-1 yj) / (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / e (xi-2 xi-1 xi, yj-2 yj-1 yj) / A B (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / d Considering only exons

1. We don’t know exactly where are the splicing sites 2. Length of introns may not be a multiple of 3 - If convert the whole seq into triplets, may result in ORF shift 17 bases? Mouse putative gene human ORF

Model introns 1. Most splicing sites start at GT and end at AG 2. For simplicity, assume length of exon is a multiple of 3 • Not true in reality • Only a little more work without this assumption GT…………AG Mouse putative gene human ORF 126 nt = 42 aa 120 nt = 40 aa

Aligning genomic DNA to ORF Fixed cost to have an intron Alignment with Affine gap penalty

FSA for aligning genomic DNA to ORF (xi-2 xi-1 xi, yj-2 yj-1 yj) / (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / e (xi-2 xi-1 xi, yj-2 yj-1 yj) / A B (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / d Considering only exons

FSA for aligning genomic DNA to ORF (xi-2 xi-1 xi, yj-2 yj-1 yj) / (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / e Start an intron (xi-2 xi-1 xi, yj-2 yj-1 yj) / (-, GT) / s A B (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / d C

FSA for aligning genomic DNA to ORF Continue in intron (xi-2 xi-1 xi, yj-2 yj-1 yj) / (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / e Start an intron (xi-2 xi-1 xi, yj-2 yj-1 yj) / (-, GT) / s A B (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / d (-, yi) / 0 C

FSA for aligning genomic DNA to ORF Continue in intron (xi-2 xi-1 xi, yj-2 yj-1 yj) / (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / e (-, yi) / 0 Start an intron (xi-2 xi-1 xi, yj-2 yj-1 yj) / (-, GT) / s A B (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / d (-, AG) / s Close an intron C

(xi-2 xi-1 xi, yj-2 yj-1 yj) / (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / e (-, yj) / 0 (xi-2 xi-1 xi, yj-2 yj-1 yj) / A (-, GT) / s (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / d B (-, AG) / s A(i-3, j-3) + (xi-2 xi-1 xi, yj-2 yj-1 yj) A(i, j) = max B(i-3, j-3) + (xi-2 xi-1 xi, yj-2 yj-1 yj) C(i, j-2) + s, if yj-1 yj == ‘AG’ C

(xi-2 xi-1 xi, yj-2 yj-1 yj) / (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / e (-, yj) / 0 (xi-2 xi-1 xi, yj-2 yj-1 yj) / A (-, GT) / s (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / d B (-, AG) / s A(i, j-3) + d A(i-3, j) + d B(i, j) = max B(i, j-3) + e B(i-3, j) + e C

(xi-2 xi-1 xi, yj-2 yj-1 yj) / (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / e (-, yj) / 0 (xi-2 xi-1 xi, yj-2 yj-1 yj) / A (-, GT) / s (xi-2 xi-1 xi, - ) or (-, yj-2 yj-1 yj) / d B (-, AG) / s B(i, j-2) + s, if yj-1 yj == ‘GT’ C(i, j) = max C(i, j-1) C

ACGGATGCGATCAGTTGTACTACGAGCTGACGGTCCTCAGACTTGATTA

• There is a close relationship between dynamic programming, FSA, regular expression, and regular grammar • Using FSA, you can design more complex alignment algorithms • If you can draw the state diagram for a problem, it can be easily formulated into a DP problem – In particular, Hidden Markov Models – Will discuss more in a few weeks

Heuristic Local Aligners BLAST and alike

State of biological databases Sequenced Genomes: Human Mouse Neurospora Tetraodon Drosophila Rice sea squirts 3 109 2. 7 109 4 107 3 108 1. 2 108 1. 0 109 1. 6 108 Current rate of sequencing: 4 big labs 3 109 bp /year/lab 10 s small labs Yeast Rat Fugu fish Mosquito Worm Arabidopsis 1. 2 107 2. 6 109 3. 3 108 2. 8 108 1. 0 108 1. 2 108

State of biological databases Number of genes in these genomes: Vertebrate: ~30, 000 Insects: ~14, 000 Worm: ~17, 000 Fungi: ~6, 000 -10, 000 Small organisms: 100 s-1, 000 s Each known or predicted gene has an associated protein sequence >1, 000 known / predicted protein sequences

Some useful applications of alignments Given a newly discovered gene, - Does it occur in other species? - How fast does it evolve? Assume we try Smith-Waterman: Our new gene 104 The entire genomic database 1010 - 1011 May take several weeks!

Some useful applications of alignments Given a newly sequenced organism, - Which subregions align with other organisms? - Potential genes - Other biological characteristics Assume we try Smith-Waterman: Our newly sequenced mammal 3 109 The entire genomic database 1010 - 1011 > 1000 years ? ? ?

BLAST • Basic Local Alignment Search Tool – Altschul, Gish, Miller, Myers, Lipman, J Mol Biol 1990 – The most widely used comp bio tool – The most cited paper • Which is better: long mediocre match or a few nearby, short, strong matches with the same total score? – score-wise, exactly equivalent – biologically, later may be more interesting, & is common – at least, if must miss some, rather miss the former • BLAST is a heuristic emphasizing the later – speed/sensitivity tradeoff: BLAST may miss former, but gains greatly in speed

BLAST Main idea: 1. Construct a dictionary of all the words in the query 2. Initiate a local alignment for each word match between query and DB Running Time: O(MN) However, orders of magnitude faster than Smith-Waterman query DB

BLAST Original Version …… Dictionary: All words of length k (~11 for DNA, 3 for proteins) Alignment initiated between words of alignment score T (typically T = k) query …… Alignment: Ungapped extensions until score below statistical threshold Output: All local alignments with score > statistical threshold scan DB query

BLAST Original Version k = 4, T = 4 The matching word GGTC initiates an alignment Extension to the left and right with no gaps until alignment falls < 50% Output: GTAAGGTCC GTTAGGTCC C T T C C T G G A T T G C G A Example: A C G A A G T A A G G T C C A G T

Gapped BLAST • • Pairs of words can initiate alignment Extensions with gaps in a band around anchor Output: GTAAGGTCCAGT GTTAGGTC-AGT C T G A T C C T G G A T T G C G A Added features: A C G A A G T A A G G T C C A G T
![Example Query: gattacaccccgattaca (29 letters) [2 mins] Database: All Gen. Bank+EMBL+DDBJ+PDB sequences (but no Example Query: gattacaccccgattaca (29 letters) [2 mins] Database: All Gen. Bank+EMBL+DDBJ+PDB sequences (but no](http://slidetodoc.com/presentation_image_h/2bb60009f4c710b965cdf786c94f1ec9/image-60.jpg)
Example Query: gattacaccccgattaca (29 letters) [2 mins] Database: All Gen. Bank+EMBL+DDBJ+PDB sequences (but no EST, STS, GSS, or phase 0, 1 or 2 HTGS sequences) 1, 726, 556 sequences; 8, 074, 398, 388 total letters >gi|28570323|gb|AC 108906. 9| Oryza sativa chromosome 3 BAC OSJNBa 0087 C 10 genomic sequence, complete sequence Length = 144487 Score = 34. 2 bits (17), Expect = 4. 5 Identities = 20/21 (95%) Strand = Plus / Plus Query: Sbjct: 4 tacaccccgattacaccccga 24 ||||||||||||| 125138 tacacccagattacaccccga 125158 Score = 34. 2 bits (17), Expect = 4. 5 Identities = 20/21 (95%) Strand = Plus / Plus Query: Sbjct: 4 tacaccccgattacaccccga 24 ||||||||||||| 125104 tacacccagattacaccccga 125124 >gi|28173089|gb|AC 104321. 7| Oryza sativa chromosome 3 BAC OSJNBa 0052 F 07 genomic sequence, complete sequence Length = 139823 Score = 34. 2 bits (17), Expect = 4. 5 Identities = 20/21 (95%) Strand = Plus / Plus Query: Sbjct: 4 tacaccccgattacaccccga 24 ||||||||||||| 3891 tacacccagattacaccccga 3911
![Example Query: Human atoh enhancer, 179 letters [1. 5 min] Result: 57 blast hits Example Query: Human atoh enhancer, 179 letters [1. 5 min] Result: 57 blast hits](http://slidetodoc.com/presentation_image_h/2bb60009f4c710b965cdf786c94f1ec9/image-61.jpg)
Example Query: Human atoh enhancer, 179 letters [1. 5 min] Result: 57 blast hits 1. gi|7677270|gb|AF 218259. 1|AF 218259 Homo sapiens ATOH 1 enhanc. . . gi|22779500|gb|AC 091158. 11| Mus musculus Strain C 57 BL 6/J ch. . . gi|7677269|gb|AF 218258. 1|AF 218258 Mus musculus Atoh 1 enhanc. . . gi|28875397|gb|AF 467292. 1| Gallus gallus CATH 1 (CATH 1) gene. . . gi|27550980|emb|AL 807792. 6| Zebrafish DNA sequence from clo. . . gi|22002129|gb|AC 092389. 4| Oryza sativa chromosome 10 BAC O. . . gi|22094122|ref|NM_013676. 1| Mus musculus suppressor of Ty. . . gi|13938031|gb|BC 007132. 1| Mus musculus, Similar to suppres. . . 2. 3. 4. 5. 6. 7. 8. 355 1 e-95 264 4 e-68 256 9 e-66 78 5 e-12 54 7 e-05 44 0. 068 42 0. 27 gi|7677269|gb|AF 218258. 1|AF 218258 Mus musculus Atoh 1 enhancer sequence Length = 1517 Score = 256 bits (129), Expect = 9 e-66 Identities = 167/177 (94%), Gaps = 2/177 (1%) Strand = Plus / Plus Query: 3 tgacaatagagggtctggcagaggctcctggccgcggtgcggagcgtctggagca 62 ||||||||||||||||||| Sbjct: 1144 tgacaatagaggggctggcagaggctcctggccccggtgcggagcgtctggagca 1203 Query: 63 cgcgctgtcagctggtgagcgcactctcctttcaggcagctccccggggagctgtgcggc 122 |||||||||||||||| Sbjct: 1204 cgcgctgtcagctggtgagcgcactc-gctttcaggccgctccccggggagctgagcggc 1262 Query: 123 cacatttaacaccatcatcacccctccccggcctcctcaacctcggcctcctcctcg 179 ||||||| || ||||||||||| Sbjct: 1263 cacatttaacaccgtcgtca-ccctccccggcctcctcaacatcggcctcctcctcg 1318

Different types of BLAST • blastn: search nucleic acid database • blastp: search protein database • blastx: you give a nucleic acid sequence, search protein database • Tblastn: you give a protein sequence, search nucleic acid database • tblastx: you give a nucleic database, search nucleic acid database, implicitly translate both into protein sequences

Variants of BLAST MEGABLAST: Optimized to align very similar sequences Linear gap penalty NCBI-BLAST: WU-BLAST: (Wash Univ BLAST) Optimized, added features BLAT: Blast-Like Alignment Tool Blast. Z: Optimized for aligning two genomes PSI-BLAST: BLAST produces many hits Those are aligned, and a pattern is extracted Pattern is used for next search; above steps iterated Sensitive for weak homologies Slower

Pattern hunter • Instead of exact matches of consecutive matches of k-mer, we can • look for discontinuous matches – My query sequence looks like: • ACGTAGACTAGCAGTTAAG – Search for sequences in database that match • AXGXAGXCTAXC • X stands for don’t care • Seed: 10101101

Pattern hunter • A good seed may give you both a higher sensitivity and higher specificity • You may think 110110 is the best seed • Because mutation in the third position of a codon often doesn’t change the amino acid • Best seed is actually – 11010010101111 • How to design such seed is an open problem • May combine multiple random seeds
- Slides: 65