Click to add title Click to add subtitle
Click to add title Click to add subtitle
Part 1. “Traditional Biology”
Agriculture, Food, Nutrition
Medicine & Nursing
Physiology
Pharmacy Science & Pharmacology
Forensics
Environment & Ecology
Occupational & Environmental Health/Safety
Biochemistry
• Biology Abstracting & Indexing Services • Pharmaceutisches Central-Blatt 1830 • Engineering Index 1884 • Index Medicus 1879 (MEDLINE & Pub. Med) • Science Abstracts 1898 • Chemical Abstracts (Sci. Finder Scholar) 1907 • Biological and Agricultural Index 1916/18 • Biological Abstracts 1926 • Abstracts of Bacteriology 1917 -26 • Botanical Abstracts 1918 -26 • Applied Science and Technology 1932 Abstracts • Excerpta Medica 1947
• Biology A&I Services, cont. • • • Science Citation Index Genetics Abstracts* Nucleic Acid Abstracts * Amino Acid, Peptide, and Protein Abstracts BIOETHICSLINE Biology Digest * Biotechnology Research Abstracts * Derwent Biotechnology Abstracts Current Biotechnology Current Advances in Biochemistry Current Advances in Genetics and Molecular Biology 1961 1968 1970 1972 1973 1974 1982 1983 1984
• • • Oncogenes and Growth Factors Abstracts * 1989 Plant Genetic Resources Abstracts 1992 Current Advances in Protein Biochemistry 1992 Applied Science and Technology Abstracts 1993 Bioengineering Abstracts Medical and Pharmaceutical Biotechnology 1993 Abstracts • Scopus 2004 Trend for increased specialization of topical coverage of bibliographic databases * CSA Cambridge Scientific Abstracts
Final Four
In the Library Literature • Library, Information Science & Technology Abstracts with Full Text • 478 Titles • Journal of the American Society for Information Science & Technology • Journal of the American Medical Informatics Association • Journal of the Medical Library Association • Information Retrieval • World Patent Information • Medical Reference Services Quarterly
Growth of Literature 70000 Nucleic Acids, DNA, RNA, Bioinformatic, Genomics in CA 60000 # of Citations 50000 40000 Nucleic Acids 30000 Bioinformatics Proteomics 20000 10000 0 1920 1940 1960 Year 1980 2000 2010
Sci. Finder Scholar — It’s Not Just Chemistry
Part 2. Digging Deeper: “The New Biology”
Biological Information in the Post-Genomic Era Dominated by Molecular Biology
It Starts with DNA — The Molecule of Life
Wo. S Journal Coverage 2005 -2011: 439, 459 PLo. S One J. Biol. Chem. PNAS Nucleic Acids Res. J. Virology Biochem. Biophys. Res. Commun. J. Bacteriol. BMC Genomics 7512 7484 7076 5756 4055 3242 3034 2926
A Brief History — Friedrich Mieschler • “Friedrich Miesclher: The Man Who Discovered DNA” • by George Wolf in Chemical Heritage 21(2): 10 -11, 37 -41, 2003 • 1869 (not published until 1871) • Nuclein • Proteins 1838 • Gerardus Johannes Mulder • Jöns Jakob Berzelius • leukocyte nuclei from (pus) • Looking for chemical composition of tissues • High phosphate • Sperm of Salmo salar • Almost entirely nuclein
Albrecht Kossel Nobel Prize ~ 1910 Physiology & Medicine • Physiological chemist and medical doctor • Studied proteins and nucleins • Discovered a protein-like composition of nucleins • Also a non-protein component: nucleic acids • • • Adenine Cytosine Guanine Thymine Uracil • 1 st Nobel Prize (nucleic acids)
James Watson & Francis Crick 1962 • DNA not a protein • Erwin Chargaff • Equal number of A—T bases • Equal number of C—G bases • Linus Pauling • Helical shape of protein • X-Ray crystallography • Franklin’s Photo 51 • Form of A, C, G, T bases • Avery, Mac. Leod, & Mc. Carty • DNA linked to heredity • DNA “transforming factor” • Nobel with Maurice Wilkins
Rosalin Franklin — The Dark Lady of DNA • Determined chemical structure of DNA by molecular structure and X-ray crystallography • Photo of the DNA molecule taken by Rosalin Franklin • Photo shown to Watson by Maurice Wilkins, co-worker of Franklin and who shared Nobel Award with Watson & Crick • Photo 51 • She didn’t know her photo was shown to them
Staying Current • The Scientist • www. the-scientist. com/ • Chemical & Engineering News • • pubs. acs. org/cen/index. html Science • www. sciencemag. org/ Nature • www. nature. com/genomics/ Bio-IT World • www. bioitworld. com/index. html • Nucleic Acid Research • 1 st January issue—Database Reviews (became “Database Issue” 2004) • Reviews and updates of database developments • 40 -50 articles per issue (1996 to present) • 1 st July issue—Web/Internet Reviews (became “Web Servers Issue” 2004) • Reviews Web servers and services • 40 -50 articles per issue (2003 to present) nar. oupjournals. org/contents-by-date. 0. shtml
Books
Human Genome Project
Evolution of the “New Biology” Biology & Life Sciences Biochemistry & Medicine Genetics Cell Biology & Physiology Genomics Proteomics Physics Polymer Physics DNA/RNA Structure & Folding Molecular & Structural Biology/Genetics Chemistry Medicinal/Pharmacy Combinatorial Chemistry Instrumentation Engineering Biotechnology Robotics Laboratory Automation Informational Molecular Biology, Computational Biology, Systems Biology Chemical Biology Mathematics & Statistics Computer Science Topology & Knot Theory Hardware Configuration & Software Development Algorithmic Theory, Gene Mapping, Micro-Array Analysis Bioinformatics Information Science Applications Simulations and Modeling Visualization Data Archives
Growth of Genomic Data & Access
Managing the Data & Information www. ncbi. nlm. nih. gov • Established in 1988 • public databases, • conducts research in computational biology • develops software tools for analyzing genome data • disseminates biomedical information • National Center for Biotechnology Information (NCBI)
NCBI at a (VERY QUICK) Glance 1 gcgggcaggagg ccgggaggaggcggcggcgg cggcggcggc 61 gagagcccag agccagagcc cggccggggc cgagcggagc gcggcggcggc 121 ggcggctggg ccgggagagg ctggcgcgcc gggcggctcc gcgaatcctc cggcatccgc 181 cccggcgggc cgcccccgcc cgcggcagcc ccccgagcag tggcccggca tcggcgcctt 241 cccggcgggc aagagtgagc catggagcta cgtgtgggga acaagtaccg cctgggacgg 301 aagatcggga gcgggtcctt cggagatatc tacctgggtg ccaacatcgc ctctggtgag 361 gaagtcgcca tcaagctgga gtgtgtgaag acaaagcacc cccagctgca catcgagagc 421 aagttctaca agatgatgca gggtggcgtg gggatcccgt ccatcaagtg gtgcggagct 481 gagggcgact acaacgtgat ggtcatggag ctgctggggc ctagcctcga ggacctgttc 541 aacttctgtt cccgcaaatt cagcctcaag acggtgctgc tcttggccga ccagatgatc 601 agccgcatcg agtatatcca ctccaagaac ttcatccacc gggacgtcaa gcccgacaac 661 ttcctcatgg ggctggggaa gaagggcaac ctggtctaca tcatcgactt cggcctggcc 721 aagaagtacc gggacgcccg caccag cacattccct accgggaaaa caagaacctg 781 accggcacgg cccgctacgc ttccatcaac acgcacctgg gcattgagca aagccgtcga 841 gatgacctgg agagcctggg ctacgtgctc atgtacttca acctgggctc cctgccctgg 901 caggggctca aagcagccac caagcgccag aagtatgaac ggatcagcga gaagaagatg
Data Repository for ALL U. S. Genome R&D
NCBI Science Primer—Basics of Biology
Having a BLAST with NCBI
Chromosome Mapping
Database Integration
Training
Click to add title
- Slides: 44