Chapter 2 Genes Genetic Codes and Mutation ChauTi

Chapter 2 Genes, Genetic Codes, and Mutation Chau-Ti Ting ctting@ntu. edu. tw Unless noted, the course materials are licensed under Creative Commons Attribution-Non. Commercial-Share. Alike 3. 0 Taiwan (CC BY-NC-SA 3. 0)

DNA Neucleotides { Phosphate Deoxyribose sugar Nitrogen base Adenine Guanine Cytosine Thymine Purine Pyrimidine

5‘ S A S S G C P S S T A P P 3‘ P T S 5‘ National Taiwan University Chau-Ti Ting 3‘

Source: National Institute of General Medical Sciences (NIGMS) http: //images. nigms. nih. gov/index. cfm? event=view. Detail&image. ID=2542

One-letter abbreviations for the DNA alphabet B x H A M x D C G R W S Y x K T x V National Taiwan University Chau-Ti Ting

RNA Single-stranded nucleotides Ribose sugar in its nucleotides, rather than deoxyribose Four nitrogenous bases: A, C, G, U (uracil) A: U G: C

DNA replication: semiconservative replication The polymerization process DNA polymerase 5' to 3' DNA polymerase acts at the replication fork Leading strand Lagging strand 1. RNA oligonucleotides (primer) copied from DNA 2. DNA polymerase elongates with new DNA Okazaki fragment 3. DNA polymerase moves 5' RNA at the end of neighboring fragment and fills gap 4. DNA ligase joins adjacent fragments http: //en. wikipedia. org/wiki/DNA_replication

Wikipedia Madprime

The nature of genes (Fig. 2 -4) Prokaryotes gene = regulatory region + coding region + transcription termination signals Eukaryotes gene = regulatory region + exons + introns + transcription termination signals

Intron Flanking region 5’ Initiation codon GC box CAAT box TATA box 19 -27 bp upstream of the transcription startpoint Exon Stop codon Transcription initiation AATAAA box Poly(A) site 30 bp upstream of the 3’ end of the intron Intron 5’ Transcription termination TACTAAC box Promoter region GT National Taiwan University Chau-Ti Ting 3’ 3’ AG GT-AG rule

Pseudogenes A pseudogene is a nongenic DNA segment that exhibits a high degree of similarity to a functional gene but which contains defects, such as nonsense and frameshift mutations, that prevent it from being expressed properly. Source: Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution. , p. 14. Sinauer Associates, Inc. Sunderland, MA, USA.

Wikipedia Dhorspool

Amino Acids The basic building blocks of proteins. There are 20 different amino acid types. Each protein consists of a different sequence of amino acids linked together according to the genetic information encoded in DNA. Source: Howard Hughes Medical Institute -NH 2 (amine) group http: //www. hhmi. org/genetictrail/glossary. html -COOH (carboxyl) group side chain (-R group)

Proteins A molecule composed of amino acids linked together in a particular order specified by a gene's DNA sequence. Proteins perform a wide variety of functions in the cell; these include serving as enzymes, structural components, or signaling Source: Howard Hughes Medical Institute molecules. http: //www. hhmi. org/genetictrail/glossary. html Peptide Residue two or more amino acids linked together Source: Howard Hughes Medical Institute http: //www. hhmi. org/genetictrail/glossary. html each amino acid in a polypeptide http: //en. wikibooks. org/wiki/Structural_Biochemistry/Proteins/Structures N terminus terminated with free amine group http: //en. wikipedia. org/wiki/N-terminus C terminus terminated by a free carboxyl group http: //en. wikipedia. org/wiki/C-terminus

Genetic Code • Codon: a section of DNA (3 nucleotide pairs in length) that encodes a single amino acid. • Genetic code: The set of correspondences between nucleotide pair triplets in DNA and amino acid in protein. • Stop codons (termination codons) can be recognized by release factors. http: //en. wikipedia. org/wiki/Stop_codon#cite_note-0 ATA TGT ATA AAG GCA Ile Cys Ile Lys Ala Source: A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7 th edition. W. H. Freeman and Company. New York, USA. http: //www. ncbi. nlm. nih. gov/books/NBK 21878/

(a) (b) (c) (d) AGGCAAACCTACTGGTCTTAT AGGCAAATCTACTGGTCTTAT AGGCAAACCTACTGCAAACAT original sequence C to T transition G to C transversion recombination GTCTT ACCTA (e) AGGCAACTGGTCTTAT deletion of ACCTA (f) AGGCAAACCTACTAAAGCGGTCTTAT insertion of AAAGC (g) AGGTTTGCCTACTGGTCTTAT Source: Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution. , p. 26. Sinauer Associates, Inc. Sunderland, MA, USA. inversion of GCAAAC

Substitution mutations Transition Transversion changes beween A and G, or between T and C changes between a purine and a pyrimidine Source: Marjorie A. Hoy 2003. Insect molecular genetics: an introduction to principles and applications, 2 nd edition, p. 23. Academic Press. USA. Synonymous (silent mutations) Nucleotide changes in the encoding part of a gene that do not result in a change in the amino acid sequence of the encoded protein. Source: A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7 th edition. W. H. Freeman and Company. New York, USA. Nonsynonymous (replacement mutations) Nucleotide changes in the encoding part of a gene that result in a change in the amino acid sequence of the encoded protein. Source: A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7 th edition. W. H. Freeman and Company. New York, USA. DNA m. RNA Amino acid CCG Proline CTG CUG Leucine CTC CUC Leucine

Types of Mutation Nucleotide substitution Replacement mutations: Nucleotide changes in the encoding part of a gene that result in a change in the amino acid sequence of the encoded protein. Silent mutations: Nucleotide changes in the encoding part of a gene that do not result in a change in the amino acid Source: A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. sequence of the encoded protein. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7 th edition. W. H. Freeman and Company. New York, USA. DNA CCG CTC m. RNA CCG CUC Amino acid Proline Leucine Addition or deletion (frameshift mutations) Deletion Wild type UUG CUG AGG CCC GAG U…. Deletion UUG CGA GGC CCG AGU ……

(a) synonymous Ile Cys Ile ATA TGT ATA Lys AAG Ala GCA Leu CTG ATA Ile Val GTC GTA Val Leu CTG Leu TTA Thr ACA CTG Leu TTA Leu ACA Thr Leu CTG Leu TTA Thr ACA TGT Cys ATA Ile AAG Lys GCA Ala CTG Leu (b) missense Ile Cys ATA TGT Ile ATA Lys AAG Ala GCA Leu CTG ATA Ile TGT Cys ATA Ile AAG Lys GCA Ala CTG Leu Val GTC TTA Phe (c) nonsense Ile Cys ATA TGT Ile ATA Ala GCA Leu CTG Val GTC ATA Ile Lys AAG TAG Stop TGT Cys GCACTGGTACTGTTAACA Source: Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution. , p. 27. Sinauer Associates, Inc. Sunderland, MA, USA.

Recombination Crossing over (reciprocal recombination) Gene conversion (non-reciprocal recombination) Deletions and insertions mechanisms unequal crossing over intrastrand deletion replication slippage indel = insertion-or-deletion frameshift mutation Deletion Wild type UUG CUG AGG CCC GAG U…. Deletion UUG CGA GGC CCG AGU ……

Copyright Declaration Work Licensing Author/Source Page P 3 National Taiwan University Chau-Ti Ting National Institute of General Medical Sciences (NIGMS) http: //images. nigms. nih. gov/index. cfm? event=view. Detail&image. ID=2542 2012/02/24 visited This work is used subject to the fair use doctrine of : • Article 46, 52 & 65 Taiwan Copyright Act. • Permission for Use NIGMS Image Gallery http: //images. nigms. nih. gov/ P 4 P 5 National Taiwan University Chau-Ti Ting P 8 Wikipedia Madprime http: //en. wikipedia. org/wiki/File: DNA_replication_split. svg 2012/02/22 visited P 10 National Taiwan University Chau-Ti Ting P. 11. “A pseudogene is a nongenic DNA segment that exhibits a high degree of … that prevent it from being expressed properly. ” Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution. , p. 14. Sinauer Associates, Inc. Sunderland, MA, USA. It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P 11

Work Licensing Author/Source Page Wikipedia Dhorspool http: //en. wikipedia. org/wiki/File: Central_Dogma_of_Molecular_Biochemistry_with_Enz ymes. jpg 2012/02/22 visited P 12 P. 13. “The basic building blocks of proteins … linked together according to the genetic information encoded in DNA. ” Howard Hughes Medical Institute http: //www. hhmi. org/genetictrail/glossary. html 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act and copyright notice of HHMI (http: //www. hhmi. org/popups/copyright. html) P 13 P. 14. “A molecule composed of amino acids linked together in … structural components, or signaling molecules. ” Howard Hughes Medical Institute http: //www. hhmi. org/genetictrail/glossary. html 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act and copyright notice of HHMI (http: //www. hhmi. org/popups/copyright. html) P 14 P. 14. “Peptide two or more amino acids linked together” Howard Hughes Medical Institute http: //www. hhmi. org/genetictrail/glossary. html 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act and copyright notice of HHMI (http: //www. hhmi. org/popups/copyright. html) P 14 Wikipedia National Human Genome Research Institute (NHGRI) http: //en. wikipedia. org/wiki/File: Protein-primary-structure. png 2012/02/22 visited Wikipedia Ladyof. Hats http: //en. wikipedia. org/wiki/File: Main_protein_structure_levels_en. svg 2012/02/22 visited P. 17. “Codon: a section of DNA (3 nucleotide pairs in length) that encodes a single amino acid. ” A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7 th edition. W. H. Freeman and Company. New York, USA. http: //www. ncbi. nlm. nih. gov/books/NBK 21878/ 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P 15 P 16 P 17 24

Work P. 17. “Genetic code: The set of correspondences between nucleotide pair triplets in DNA and amino acid in protein. ” Licensing Author/Source Page A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis. 7 th edition. W. H. Freeman and Company. New York, USA. http: //www. ncbi. nlm. nih. gov/books/NBK 21878/ 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act. P 17 Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution. , p. 26. Sinauer Associates, Inc. Sunderland, MA, USA. It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P 18 P. 19. “Transition changes beween A and G, or between T and C Transversion changes between a purine and a pyrimidine” P 19 Marjorie A. Hoy 2003. Insect molecular genetics: an introduction to principles and applications, 2 nd edition, p. 23. Academic Press. USA. http: //books. google. com. tw/books? id=MPkwi-i 33 z. YC&printsec=frontcover&hl=zh. TW#v=onepage&q&f=false 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P. 19, 20. “Nucleotide changes in the encoding part of a gene that do not result in a change in the amino acid sequence of the encoded protein. ” A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7 th edition. W. H. Freeman and Company. New York, USA. http: //www. ncbi. nlm. nih. gov/books/NBK 21878/ 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P 19, 20 P. 19, 20. “Nucleotide changes in the encoding part of a gene that result in a change in the amino acid sequence of the encoded protein. ” A. J. F. Griffiths, J. H. Miller, D. T. Suzuki, R. C. Lewontin, and W. M. Gelbart. 2000. An Introduction to Genetic Analysis, 7 th edition. W. H. Freeman and Company. New York, USA. http: //www. ncbi. nlm. nih. gov/books/NBK 21878/ 2012/02/22 visited It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P 19, 20 Dan Graur and Wen-Hsiung Li 2000. Fundamentals of Molecular Evolution. , p. 27. Sinauer Associates, Inc. Sunderland, MA, USA. It is used subject to fair use doctrine in accordance with Articles 52 & 65 of Taiwan Copyright Act P 21 25