Chapter 2 Basics of DNA Biology and Genetics

Chapter 2 Basics of DNA Biology and Genetics Fundamentals of Forensic DNA Typing Slides prepared by John M. Butler June 2009

Chapter 2 – DNA Biology Review Chapter Summary Deoxyribonucleic acid (DNA), which is composed of a four letter alphabet (A, T, C, and G), provides the blueprint of life and is found in each nucleated cell of our body. Within the nucleus of each cell (except red blood cells which have no nucleus), humans have 23 pairs of chromosomes with each member of each chromosome pair being inherited from either one’s father or one’s mother. Specific regions of DNA can be examined to generate a DNA profile. Population studies of various groups are performed in order to measure observed genetic variation with the DNA markers tested. The most widely used DNA marker today in forensic and human identity testing applications is the short tandem repeat (STR).

Methods for Human Identification Fingerprints have been used since 1901 DNA since 1986

Some Basic Principles of DNA = Deoxyribo-Nucleic Acid • It is in almost every cell of our bodies • Found in a long strand, like a piece of rope • Made up of a simple alphabet containing four letters: A, T, C, G • The order of these letters is what makes everyone different • Over 99% of human DNA is the same from person-to-person

DNA in the Cell The vast majority of DNA is the same from person to person chromosome 22 pairs + XX or XY cell nucleus Double stranded DNA molecule ~3 billion total base pairs Only a Small Varying Region is Targeted and Probed for Each DNA Marker Examined Individual nucleotides

Organization of Information Printed Genetic 1 2 3 4 5 6 Volumes in a Set of Encyclopedias 23 Pairs of Chromosomes in a Cell

Information Storage You know that no two people share the same fingerprint, but did you know that the cells that make up your body also have a unique fingerprint unlike anyone else’s? Your cells contain a complex molecule that we call DNA. Unless you have an identical twin, no one else has DNA just like yours. Scientists can analyze DNA. If a criminal leaves DNA at a crime scene, police can use it to prove who committed the crime. At NIST, we help crime labs analyze DNA accurately. We make DNA standards so crime labs can tell if their results are right. Text Storage is by the order of letters, words and paragraphs DNA Storage is by the order of nucleotides, genes and chromosomes

John M. Butler (2009) Fundamentals of Forensic DNA Typing, Table 2. 1 Identification of Information Printed Information Genetic Information Library Body Book Cell D 13 S 317 Chapter Nucleus Page Number Chromosome Line on Page Locus (part of chromosome) Word Short DNA sequence Letter DNA nucleotides

Nuclear DNA - Located in cell nucleus Autosomes http: //www. ncbi. nlm. nih. gov/genome/guide/ Only single copy of each autosome shown John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2. 3 The Human Genome 2 copies per cell Located in mitochondria (multiple copies in cell cytoplasm) mt. DNA 1 2 3 4 5 6 7 8 9 10 11 12 16, 569 bp mt. DNA 13 14 15 16 17 18 19 20 21 22 X 3. 2 billion bp Y Sexchromosomes 100 s of copies per cell

Cell Nucleus – 3 billion bp Autosomes – 22 pairs – 2 copies per cell Sex Chromosomes (XX or XY) mitochondria – in cell cytoplasm 100 s of mt. DNA copies per cell

Sex chromosome Maternal Contribution Sperm (haploid) 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Sex chromosome Paternal Contribution or 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Nuclear DNA Zygote (diploid) mt. DNA X Autosomes Sex chromosomes 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Male Child’s Full Genome Y XY X Mitochondrial DNA mt. DNA John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2. 7 Egg (haploid) Human Genome and Inheritance

The Nucleus = control center for the cell (one per cell) http: //en. wikipedia. org/wiki/Image: Biological_cell. svg http: //en. wikipedia. org/wiki/Image: Diagram_of_an_animal_mitochondrion. svg The Human DNA Genome within a Cell Mitochondria = the power houses for the cell (hundreds per cell) Mitochondrial DNA (16, 569 bp) Inherited from only your mother Nuclear DNA (3. 2 billion bp) Inherited from both your mother and your father

http: //www. genome. gov/10001772 http: //www. ncbi. nlm. nih. gov/genome/guide/human/ John M. Butler (2009) Fundamentals of Forensic DNA Typing, D. N. A. Box 2. 1 The Human Genome Project • Molecular biology’s equivalent to NASA’s Apollo space program began in 1990 and concluded in 2003 following a multi-billion dollar effort to decipher the DNA sequence contained inside a human cell • Originally lead by James Watson and from 1992 to completion by Francis Collins • For more information: http: //www. genome. gov/ and http: //www. ncbi. nlm. nih. gov/genome/guide/human/

Characteristics of DNA • Each person has a unique DNA profile (except identical twins). • Each person's DNA is the same in every cell. • An individual’s DNA profile remains the same throughout life. • Half of your DNA comes from your mother and half from your father.

Genetic Inheritance Father’s Sperm Mother’s Egg Nuclear DNA Mitochondrial DNA Current scientific thinking: • ~99. 9% of 6 billion letters (2 x 3 billion bp) are the same between people • This 0. 1% is still ~6 million differences Child’s Cell Father contributes: 22 autosomes (1 of each pair), X or Y Mother contributes: 22 autosomes (1 of each pair), X and mt. DNA

Our DNA Comes from our Parents Father’s Sperm Mother’s Egg Child’s Cell

Inheritance Pattern of DNA Profiles DAD CHILD MOM

Basis of DNA Profiling The genome of each individual is unique (with the exception of identical twins) and is inherited from parents Probe subsets of genetic variation in order to differentiate between individuals (statistical probabilities of a random match are used) DNA typing must be performed efficiently and reproducibly (information must hold up in court) Current standard DNA tests DO NOT look at genes – little/no information about race, predisposal to disease, or phenotypical information (eye color, height, hair color) is obtained

DNA Marker Nomenclature TH 01 Tyrosine Hydoxylase gene, intron 01 D 16 S 539 D: 16: S: 539: 16 DNA chromosome 16 single copy sequence 539 th locus described on chromosome

John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2. 1 Basic Components of Nucleic Acids A) B) 5’end | Phosphate | Sugar—Base… | 3’end 5’ 3’

Hybridization and Double-Helix Structure John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2. 2 Hydrogen bonds 3’ 5’ A=T G C hybridized strands Phosphate-sugar T=A backbone C G A=T A T G C C denatured G C 5’ strands 3’G 5’ A=T G C T=A C G A=T T=A C G 3’ 5’ G C 3’

Basic Chromosome Structure and Nomenclature John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2. 4 Chromosome 12 telomere p (short arm) Band 3 12 p 3 centromere q (long arm) Band 5 telomere 12 q 5

John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2. 5 Two Primary Forms of DNA Variation (A) Sequence polymorphism ----AGACTAGACATT-------AGATTAGGCATT------- (B) Length polymorphism -----(AATG)(AATG)-----3 repeats -----(AATG)-----2 repeats

John M. Butler (2009) Fundamentals of Forensic DNA Typing, Table 2. 2 Comparison of RFLP and PCR-based DNA Typing Methods

Short Tandem Repeat (STR) Markers An accordion-like DNA sequence that occurs between genes TCCCAAGCTCTTCCCTAGATCAATACAGAAGACA GGTGGATAGATAGATAGATAGATAGATATCATTGAAAGACAAAACAGAGATGATAGATACAT GCTTACAGATGCACAC = 11 GATA repeats (“ 11” is all that is reported) The number of consecutive repeat units can vary between people 7 repeats 8 repeats 9 repeats 10 repeats 11 repeats 12 repeats 13 repeats Target region (short tandem repeat) The FBI has selected 13 core STR loci that must be run in all DNA tests in order to provide a common currency with DNA profiles

Core STR Loci for the United States Position of Forensic STR Markers on Human Chromosomes 13 CODIS Core STR Loci TPOX D 3 S 1358 D 8 S 1179 D 5 S 818 FGA CSF 1 PO 1997 TH 01 VWA D 7 S 820 AMEL Sex-typing D 13 S 317 D 16 S 539 D 18 S 51 D 21 S 11 AMEL

Fluorescent dye-labeled primer Short Tandem Repeat (STR) Typing STR Repeat Region 5′ 5′ 3′ 1 2 3 4 5 6 7 (Maternal) 3′ 1 forward primer hybridization region GATA 8 (Paternal) reverse primer hybridization region (size in bp) 75…. 80…. 100…. 120…. 140…. 160…. 180…. 200…. 220…. 240. … 260…. . 1000 RFUs 500 6 139 bp 8 147 bp DNA Separation and Detection

A DNA Profile is Produced by Separating DNA Molecules by Size and Dye Color LASER Excitation (488 nm) The labeled fragments are separated (based on size) and detected on a gel or capillary electrophoresis instrument ~2 hours or less Fragment size ranges from 100 - 350 base pairs Peaks represent labeled DNA fragments separated by electrophoresis This ‘profile of peaks’ is unique for an individual – a DNA type

John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2. 6 Two STRs on Different Pairs of Homologous Chromosomes Locus A Allele 1 Allele 2 4 Homologous pair of chromosomes 5 Allele 2 Allele 1 Homologous pair of chromosomes 3 6 Locus B

Genetics and Populations • Genetics involves the study of patterns of inheritance of specific traits between parents and offspring. Rather than study inheritance patterns in single families, much of genetics today involves examining populations. • Populations are groups of individuals and are often classified by grouping together those sharing a common ancestry.

DNA Size smaller larger Paternity Testing Example Mother 8 12 Obligate allele required by the true father 8 Child 14 Has a “ 14” “INCLUDED” 12 14 Does not have a “ 14” “EXCLUDED” 11 12 Alleged Father 1 Alleged Father 2

PATERNITY TESTING PCR product size (bp) 11 14 Father’s Profile? 12 8 14 14 11 12 8 12 STR Alleles from D 13 S 317 Father 11, 14 Child #1 Child #2 Child #3 Mother Alleged Father(s) is asked to donate DNA sample ?

A DNA Profile Actually Examines Many Positions to Strengthen Confidence in the Results Position #1 Position #2 Position #3 Mother 8, 12 14, 17 17, 25 Child 8, 14 14, 18 20, 25 12, 14 18, 18 20, 21 Alleged Father 1 INCLUDED at all positions examined Alleged Father 2 11, 12 15, 16 18, 23 Can be EXCLUDED as he does not match at any of the positions examined

http: //kentsimmons. uwinnipeg. ca/cm 1504/Image 215. gif John M. Butler (2009) Fundamentals of Forensic DNA Typing, D. N. A. Box 2. 2 Gregor Mendel’s Pea Experiments: discovering basic rules for genetic inheritance • Between 1856 and 1863, Gregor Mendel, an Austrian monk, meticulously cultivated and tracked approximately 29, 000 pea plants (Pisum sativum). • He studied the following seven characteristics in his pea plants: – (1) color and smoothness of the seeds (grey and round or white and wrinkled), – (2) color of the cotyledons (yellow or green), – (3) color of the flowers (white or violet), – (4) shape of the pods (full or constricted), – (5) color of unripe pods (yellow or green), – (6) position of flowers and pods on the stems (axial or terminal), and – (7) height of the plants (short or tall). • Mendel’s work went unnoticed for many years and was rediscovered in 1900 See http: //www. mendelweb. org/Mendel. html

Laws of Mendelian Genetics • The Law of Segregation states that the two members of a gene pair segregate (separate) from each other during sex-cell formation (meiosis), so that one-half of the sex cells carry one member of the pair and the other one half of the sex cells carry the other member of the gene pair. In other words, chromosome pairs separate during meiosis so that the sex cells (gametes) become haploid and possess only a single copy of a chromosome. • The Law of Independent Assortment states that different segregating gene pairs behave independently due to recombination where genetic material is shuffled between generations.

http: //www. bioquest. org/products/auth_images/7080_HW-pic. jpg Hardy–Weinberg Equilibrium (HWE) Godfrey Hardy p 2 + 2 pq + q 2 = 1 Wilhelm Weinberg • Godfrey Hardy (1877– 1947) and Wilhelm Weinberg (1862– 1937) both independently discovered the mathematics for independent assortment that is now associated with their names as the Hardy–Weinberg principle. • HWE proportions of genotype frequencies can be reached in a single generation of random mating. HWE is simply a way to relate allele frequencies to genotype frequencies.

Father gametes (sperm) John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2. 8 Punnett Square A p Resulting genotype combinations and frequencies Mother gametes (egg) A p a AA q AA a. A p 2 qp p 2 Aa 2 pq a q Aa aa pq q 2 aa Punnett square Freq (A) = p Freq (a) = q p+q=1 (p + q)2 = p 2 + 2 pq + q 2

Relationship between Allele Frequency and Genotype Frequency 1. 0 Frequency of genotype in population John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2. 9 Frequency of A allele (p) 0. 8 0. 6 0. 4 0. 2 AA p 2 0. 0 aa q 2 Aa 2 pq 0. 6 0. 4 0. 2 0. 0 0. 2 0. 4 0. 6 Frequency of a allele (q) 0. 8 1. 0

1 (a) 23. 2, 25 3 22, 22 9 10 22, 24 11 22, 23. 2 (b) 4 22, 23. 2 20, 25 12 22, 23. 2 22, 25 #2 20 20, 23. 2 #3 14 20, 22 #5 22, 25 #7 20, 22 15 20, 25 8 20, 25 20, 22 16 20, 22 22, 25 #4 Mother’s alleles 25 #4 22 22, 23. 2 13 5 (c) Mother’s alleles 23. 2 7 Father’s alleles 6 17 #1 2 20, 22 Father’s alleles John M. Butler (2009) Fundamentals of Forensic DNA Typing, Figure 2. 10 A Three-Generation Family Pedigree with Genetic Results from a Single STR Marker (FGA) 20 20 25 20, 20 20, 25 #14 22 20, 22 #13 22, 25 #12

Chapter 2 – Points for Discussion • How can denaturation and hybridization of complementary DNA strands be controlled? • What impact has the Human Genome Project had on medicine and health? On forensic DNA testing? • Why is it important to understand the variation at specific genetic markers across many individuals in a population? • Why are some DNA markers named (e. g. , TH 01, VWA, etc. ) while others are named with D-S- designations (e. g. , D 3 S 1358)?