By Kristyn Sennett A Viral Metagenome Analysis Background

By: Kristyn Sennett A Viral Metagenome Analysis

Background �Viral metagenome used to get a comprehensive look at a viral community �Schoenfield et al. gathered thermophilic viruses from Yellowstone National Park hotsprings �Viral DNA was extracted, purified and a linker was added for ease of primer use �DNA was fragmented, amplified, and inserted into a p. SMART vector

Preparation for Analysis �Reads were received through the Bio. Bike portal �Reads were edited to remove artifacts of the linkers used in the amplification process �Reads were Blasted against other reads from the same metagenome

The Reads Oct. HS. atyb 5119 -g 2 Octopus Metagenome 996 bases in length after editing Oct. HS. atyb 5119 -b 2 Octopus Metagenome 1001 bases in length after editing Did not overlap with one another

Oct. HSe. atyb 5119 -b 2 �No overlaps with other reads to make a longer contiguous read �Significantly matched Oct. HSe. atyb 3565 -g 2 indicates from a related virus but not the same virus atyb 5119 -b 2 1 518 579 622 667 721 203 163 120 87 706 48 atyb 3565 -g 2

Oct. HS. atyb 5119 -g 2 �No overlaps with other reads to make a large contiguous read �A specific sequence of about 36 bases around coordinates 341 to 370 was found to be repeated several times in two other reads: atyb 2687 -g 2 and atyb 2687 -b 2

Repeated Sequence AACTTTCAACTCCACACGGTACATTAGGAACCC Coordinates in atyb 2687 -g 2: 22 -52 91 -119 155 -185 221 -249 287 -317 354 -382 419 -449 490 -512 Coordinates atyb 2687 -b 2: 575 -547 511 -482 445 -415 380 -351 311 -383 245 -217 180 -151 114 -86 86 -58 50 -21

Repeated Sequence �Nothing out of the ordinary with the sequence �n. BLAST returned no conclusive results

Oct. HSe. atyb 2687 g 2 and b 2 �Repeated sequence only found in the first half of each read �Reads showed no other strange features �The sequences between each repeated sequence showed no unusually features

Further Research �Look more in depth at the two reads with the repeated sequence �See if that repeated sequence is found in any othermophilic viruses or other viruses in general �Find out what that repeated sequence means in a virus

Works Cited �Shoenfield T. , M. Patterson, P. Richardson, K. E. Wommack, M. Young, D. Mead, 2008 Assembly of Viral Metagenomes from Yellowstone Hot Springs. Applied and Environmental Microbiology 74: 4164 -4174. �NCBI: http: //www. ncbi. nlm. nih. gov/ accessed on 5 May 2009.