BIOTECHNOLOGY AND GENETIC ENGINEERING Text reading LAB Lyle

BIOTECHNOLOGY AND GENETIC ENGINEERING Text reading LAB Lyle and Louis Murder Mystery LAB Splicing a plasmid LAB Extracting DNA Worksheet “Gene Technology” Worksheet Chap 16 DNA Tech Web activity http: //learn. genetics. utah. edu/content/labs/gel/

Important 3 rd Quarter Dates: § Bonus #1 – Feb. 19 § Bonus #2 – March 19 § CP #1 - Feb 11 § CP #2 – March 11 § Video – April 5

§ Vocabulary (94 -99) restriction enzyme, plasmid, gene cloning, gene therapy, chimera, hybrid § read 226 -228, 234, 236 -239, 246, 247 for next section on genetic engineering § BIOTECHNOLOGY ARTICLES TO READ (ques. due Wednesday) (13 pts. )

Definitions… § Technology – any tool that makes life easier (toothpick, phone, space shuttle, screwdriver, computer) § Biotechnology – the tool is a living creature that makes our life easier or better (usually dealing at the cellular or DNA level but might also include a cow pulling a plow) § Genetic Engineering - modification of the DNA in an organism or exchange of DNA between organisms – why would we want to do this?

The next slides are just reminders of concepts

BASICS OF INHERITANCE § DNA is the hereditary molecule § BLUE PRINT for all traits § Universal and Interchangeable

HUMAN CHROMOSOMES § Coiled strands of DNA § 23 pairs of chromosomes § 23 from ♀ egg § 23 from ♂ sperm

I. Sexual reproduction § ADD DRAWING TO NEXT PAGE

II. Hybrid § Offspring produced by the mating of different species. § Every cell contains DNA from both species § Can you name some hybrid animals? Peekenese and a poodle = peek-a-poo § Horse and a donkey= mule § ADD DRAWING TO NEXT PAGE

Wolf/dog hybrid

Liger or tiglon

Zonkey or zedonk

Rat/squirrel hybrid

Llamal llama/camel hybrid

III Chimera § § § Produced in the laboratory EMBRYO FUSION- see article on "GEEP" Draw diagram of hybrid and chimera

III Chimera § § § Produced in the laboratory EMBRYO FUSION- see article on "GEEP" Draw diagram of hybrid and chimera

GEEP

IV IN VITRO FERTILIZATION Test tube babies § Procedure § female injected with hormones to cause ovulation of many eggs § Male donates sperm § Egg and sperm are mixed in a dish in a lab to create embryos § Embryo implanted in surrogate mother

Test Tube Babies § In Vitro Fertilization (IVF) and Embryo Transfer (ET) § 20% success rate

V. Surrogate Motherhood

Can be used for : § Infertile couples § Experimentation § Increase the population of endangered species § QUESTION? What do we do with the left over human embryos?

Make it exciting

VI Genetic Engineering and Moving Genes § -Human Genome Project (video) HGP READ pg. 236 § -(HGP)sequence all the base pairs in the human genome (2 -3 billion pairs) § (100, 000 genes) § -genome -all the possible bases in a species or individual

§ gene- DNA sequence that codes for a protein. The protein may lead to a visible trait (I. e. eye color, hair texture, blood type etc) § Genetic Disease- disease caused by a defective or mutant gene. Considered hereditary, if it can be passed on to the next generation (i. e. Huntingtons, Sickle Cell are major examples)

HOW GENTIC ENGINEERING IS DONE § Recombinant DNA involves 4 steps § Procedure § 1. DNA is cut and desired gene is removed § 2. gene is attached to a vector for delivery into another cell § 3. cloning - multiple copies of the gene are made by allowing the host cell to multiply § 4. screening- cells with the new gene are sorted from the multitude produced

BT Corn Insulin from bacteria Artificial insemination or embryo transfer

How is the DNA cut? (ACTIVITY HERE) § Restriction enzymes- recognize a specific DNA sequence and cuts it at every location § Eco. RI Bam. HI § GAATTC GGATCC § CTTAAG CCTAGG

§ How is the DNA delivered? § Viruses, yeast or plasmid can be used. § A plasmid is a loop of DNA that are independent of the main DNA of a bacteria cell.

§ The same restriction enzyme is used to open the plasmid. § Nucleotide pairs on the end of the gene and plasmid join in a complimentary fashion. § The gene is now part of the host’s DNA- recombinant DNA

How do the recombinant cells multiply? § Nutrients are provided to facilitate growth of bacteria § Bacteria grow- they are clones of each other § Cloning- creating exact genetic copies (bacteria, cells, embryos… humans? )

How is the DNA separated? § Electrophoresis § http: //learn. genetics. utah. edu/content/lab s/gel/

KIDS, CARS AND $$$$$

Cloning Around (reproductive cloning) § All SOMATIC CELLS (body cells) contain DNA blueprint for the individual organism § Any cell can behave like a ZYGOTE to produce an entire individual

§ The nucleus of a somatic cell isd placed inside an egg cell that has had its nucleus removed. § Electricity sparks cell division in the fertilized egg cell and an embryo is formed. § The embryo is placed in a womb or suitable environment for development.

CLONING BASICS

HISTORY OF CLONING § 1953 § 1996 § 2002 § 2003 § 2005 frog sheep cat horse dog 277 82 841 ATTEMPTS BEFORE SUCCESS

§ Reproductive Cloning is expensive and inefficient § CC cost $50, 000 § Horse 1/841. 12% § Sheep 1/277. 36%

STEM CELL RESEARCH § What’s so special about Stem Cells? § Biological immortality § Pluripotentcan become any of 220 cell types

Therapeutic potential §Pancreas beta cells to produce insulin to relieve diabetes §Dopamine producing cells in the brain to relieve Parkinson’s disease §Regrowth of missing limbs

ADULT STEM CELLS § “cells in adult tissues that are undifferentiated” § Multipotent (can become many of the 220 cell types) § Sources § bone marrow, umbilical cord, § hair follicle, skin, § adipose cells, More are known

Most well know example of Adult Stem Cell… bone marrow stem cells

VIII Moral and Ethical issues § § § § § WHY IS THIS BEING DONE? HOW IS THIS BEING DONE? WHO OR WHAT CAN IT BE DONE TO? Should this be done? Will anyone or any organism be injured? Who will benefit from this research? Are there alternatives to this procedure? How will this be paid for? What will be done after the process? Is there a danger to the environment?

TEST FRIDAY BIOTECHNOLOGY Text pages (226 -228, 234, 236 -239, 246, 247) 2 articles w/questions Worksheets Gene tech and DNA tech L and L Lab activity Interpret electrophoresis banding patterns Diagram and explain hybrids and chimera Provide examples of above Explain techniques and uses of IVF and ET Vocabulary (94 -100) Be able to answer the question “Pick one example of biotechnology that we have studied, explain what it is and provide your view of the technology”

§ Biotechnology Test Review Questions: § Easy § Small, circular piece of bacterial DNA is called a ____. § Give two examples of vectors: § The entire collection of genes within human cells is called the ________. § Difference between technology and biotechnology? § Function of restriction enzymes? § HGP stands for? How many base pairs in HG? How many proteins? § Difference between surrogate and biological mother? § A _______ is caused by a defective or mutant gene. § Define gene. § The first cell created by sexual reproduction is called a

§ Medium § 1. Inserting unrelated pieces of DNA together will result in __________. § 2. IVF stands for? What is a synonym used for IVF? § 3. What does transgenic mean? § 4. Identical twins are considered to be genetic ______. § 5. How does IVF work? What does the female have to do? What does the male have to do? § 6. Why does IVF sometimes result in twins, triplets, or quads? § 7. Difference between fraternal vs. identical twins? § 8. How does Gel Electrophoresis separate DNA fragments? § 9. What is an example of a genetic disease? § 10. What kind of ethical questions arise from IVF?

§ Difficult § What is the difference between gene therapy and genetic engineering? § Difference between a hybrid and chimera? § Steps of genetic engineering? § The Hind R 1 restriction enzyme is used to slice DNA at the GAATTC between the G and C. Illustrate how this enzyme would precisely cut the fragment: § ATTAGATCGCCCTAGAATTCAAGCTGGTAGCTACATCTA § TAATCTAGAGGGATCTTAAGTTCGACCATCGATGTAGAT § What research can be done using gel electrophoresis?