Biologists Toolkit Understanding common biological tools and techniques
Biologist’s Toolkit Understanding common biological tools and techniques
Forensic scientists collected DNA evidence from the scene of a murder and three potential suspects. Based on the DNA fingerprint, which suspect committed the murder? What is the tool called that is used to produce DNA fingerprints?
AATCCGGAATTCCTACTTGAATTCGATA TTAGGCCTTAAGGATGAACTTAAGCTAT The restriction enzyme Eco. RI cuts DNA at the recognition sequence GAATTC. How many fragments of DNA will be produced when Eco. RI cuts the above sequence? AATTCGATA GCTAT AATTCCTACTTG GGATGAAGTTAA AATCCGG TTAGGCCTTAA
Stan’s father has been losing his mental abilities and was recently diagnosed with a genetic disease. He also gets tested and finds that he has the disease. His genetic counselor draws the pedigree below to explain the inheritance of the disease. The disease Stan and his father have been diagnosed with follows what type of inheritance? The disease is most likely… A. Huntington’s Disease C. Phenylketonuria B. Sickle Cell Anemia D. Cystic Fibrosis
Which of these describes a transgenic organism? A. An extra-large strawberry bred to have an extra set of chromosomes. B. A bacterium that has been given DNA for producing the human hormone insulin. C. A boy with Fragile X syndrome who received a healthy copy of the human FMR 1 gene. DNA from one organism Vector Another organism
Which of these DNA strands will travel the farthest during gel electrophoresis? A. ATTCGACTCAGGCTG TAAGCTGAGTCCGAC B. AATTCGCGGCAGCTAGCGACGCATTAGCGATACGACGCATT TTAAGCGCCGTCGATCGCTGCGTAATCGCTATGCTGCGTAA C. TTACTCGGTCTAACATGATGCAGTCAG AATGAGCCAGATTGTACTACGTCAGTC D. AATCCGGTAC TTAGGCCATG
This genetic disease, which results in a change in red blood cell shape, can result in resistance to malaria if only one allele of the gene is inherited. What type of inheritance is demonstrated by Sickle Cell Anemia. Remember that one normal (A) allele and one sickle-trait (S) allele result in a person having blood cells of both types.
DISCUSS: In 2003, the Human Genome Project concluded and the complete sequence of genes in human DNA was made available to the public. What might be some benefits society is or will experience as a result of the Human Genome Project?
Identify the genetic disorder associated with each of the following karyotypes. Use the chart for a list of disease descriptions. Diagnosis Chromosomal Abnormality Turner Syndrome Monosomy 23 Klinefelter's Syndrome Trisomy 23 Down's Syndrome Trisomy 21 Edward’s Syndrome Trisomy 18
Identify the genetic disorder associated with each of the following karyotypes. Use the chart for a list of disease descriptions. Diagnosis Chromosomal Abnormality Turner Syndrome Monosomy 23 Klinefelter's Syndrome Trisomy 23 Down's Syndrome Trisomy 21 Edward’s Syndrome Trisomy 18
Identify the genetic disorder associated with each of the following karyotypes. Use the chart for a list of disease descriptions. Diagnosis Chromosomal Abnormality Turner Syndrome Monosomy 23 Klinefelter's Syndrome Trisomy 23 Down's Syndrome Trisomy 21 Edward’s Syndrome Trisomy 18
A doctor takes cells from a fetus (developing baby) while it is still inside the womb. The doctor uses a long hollow needle to extract the cells, which are then tested to see if the baby will have a genetic disease. The doctors are performing which treatment? A. Gene therapy B. DNA fingerprinting C. Amniocentesis D. Transgenic modification
Unlike many genetic disorders, this disease is easily treated by following a strict diet. People with the disorder should avoid eating foods that are high in the amino acid phenylalanine, such as milk, eggs and artificial sweeteners. A. Cystic Fibrosis C. Tay-Sachs Disease B. Phenylketonuria D. Hemophilia
A. What enzyme was used to cut the plasmid in picture A at the recognition site? B. What type of DNA is being produced in part B? C. If the DNA shown in part C were put into an organism, what kind of organism would be produced?
- Slides: 14