Bio 260 Day 9 genetics Chapter 7 Microbial

Bio 260 Day 9 genetics

Chapter 7 Microbial genetics

The importance of genetics • E. coli is found? • What is E. coli O 157: H 7?

The importance of genetics • E. coli is found naturally in colon, where it is beneficial. However, the strain E. coli O 157: H 7 produces Shiga toxin and is a pathogen. This is a strain difference. • How did E. coli acquire this gene from Shigella?

Terminology • What is a gene? – Instructions for making a protein (plus when-to-make info) • What is the genome? – Complement of all your genes – Ie sum of all your protein-making instructions) – Packaged in one or more chromosomes • Genetics – The study of what genes are, how they carry information, how information is expressed, and how genes are replicated How the genes are expressed detectable physical trait Genotype Phenotype

Why we should care: the practical consequence of phenotype • Genes make proteins for example? • Microbial features – structure (eg. cell wall structure, pili) and function (fermentation; nitrogen catabolism) determined by proteins which are determined by genes • Microbial diversity and identity can be determined by sequencing the microbial genome • Genetic change (change to the genotype) is the basis of acquired drug resistance and increased or decreased pathogenesis (phenotype) • Genetic engineering is used in industry to give microbes the ability to make useful proteins

Central dogma • DNA m. RNA protein • I like to start backwards

The importance of protein for cells Objects (tools, machines) made by cell for specific jobs

How cells get their work done • Cell makes protein machines to do unique celltype specific jobs (enzymes, transporters): Red blood cells O 2 Q: where does a red blood cell get its hemoglobin?

“CENTRAL DOGMA” of Molecular Biology: DIY Manual SELECTIVE USE Are all genes “ON” at any given time? How to Oxyg make en to ngs O 2

Defining DNA Instructions for life Deoxyribonucleic acid Instruction manual for cells Instructions for making proteins DNA is a polymer of what subunit? ?

Nucleotides • The basic unit of DNA: AGCT – linear sequence of nucleotides • RNA has AGCU

Nucleotide structure • Nucleobase – Information – AGCT / AGCU • Phosphate • At the 5’ end • Pentose (5 C sugar) – Orientation – P – 5’ C of sugar – OH – 3’ C of sugar

DNA or RNA sequence • sugar-phosphate backbone • sequence of nitrogenous bases

DNA is double stranded • Two linear sequences • Held together by Hydrogen bonds between base pairs: • Strands can be pulled APART • COMPLEMENTARY - know base sequence on one side? automatically know other side • ANTIPARALLEL: 5’ to 3’ - orientation is opposite for each strand Adapted from the National Human Genome Research Institute on-line glossary at http: //www. nhgri. nih. gov/DIR/VIP/Glossary/pub_glossary. cgi

Short group exercise • Draw sugar-phosphate-base structure of double stranded DNA with the following sequence: • 5’ – ATGCCCTGA – 3’ • NOTES: show it is antiparallel and complementary

DNA size and units • • • Measured in base pairs 3 bp – codon; information for one amino acid 1 kb – 1000 bp, an average gene (~333 aa) 1 Mb – 1000 kb, a million bp OUR genome: 3 billion bp; 3000 Mb – (2 meters long; nucleus is 6 um) • E coli genome: 4. 6 Mb – (3 mm; 2 um bacterium)

Eukaryotic DNA packaging eg. human: 2 m DNA 6 u. M nucleus; multiple condensed chromosomes

Prokaryotic DNA Single circular chromosome –supercoiled

Prokaryotic DNA: use, copy , share

DNA copied during cell division: “DNA replication”

How to copy DNA Parent strands • The DNA “parent” strands pull apart • Complementary bases added (A-T, C-G) • RESULT: two DNA strands that are exact copies of the original DNA • Each cell gets a complete copy • Semi-conservative (one strand is parental, one totally new) Complementary strands

DNA replication • http: //www. youtube. com/watch? v=4 jtm. OZa. I v. S 0

DNA Replication Origin (ORI) Denature/melt Primases 2 replication forks make a bubble = Bidirectional Terminating site PLUS: complementary and semi-conservative

DNA Replication • Replication begins at origin of replication – Proteins recognize and bind to site – Helicase melts the double-stranded DNA – RNA Primase synthesizes short stretches of complementary RNA called primers to start the reaction – DNA pol III replicates, DNA pol I replaces RNA primers – DNA ligase seals the breaks in the sugar-phosphate backbone • Creates two replication forks (enlarging “replication bubble”) – Leave origin going in opposite directions; bidirectional – Ultimately meet at terminating site when process complete • Leading and lagging strands (because it’s anti-parallel) – DNA pol III works 5’ to 3’ – one strand is easy – Other one done in short pieces “Okazaki fragments” by DNA pol III and pol I and primase all working together

DNA Replication – the nitty gritty • Helicases “unzip” DNA strands – What is being disrupted? Why is this necessary? • DNA polymerase synthesize in 5’ to 3’ direction – Hydrolysis of high-energy phosphate bond powers – DNA polymerase can only add nucleotides, not initiate • Require primers at origin of replication (RNA polymerase)

5’ to 3’ orientation • • • DNA is double stranded 2 linear sequences Held together by H bonds complementary ANTIPARALLEL: 5’ to 3’ • Orientation is opposite for each strand

Chemistry – adding bases

DNA Replication – the nitty gritty • The two strands are replicated differently – Leading strand synthesized continuously – Lagging strand synthesized discontinuously • • DNA polymerases can only add nucleotides to 3’ end RNA polymerase makes primers Different DNA polymerase replaces primers DNA ligase forms covalent bond between adjacent nucleotides

DNA Replication – the nitty gritty Leading – pol goes straight - one chain Lagging – bunny hops - pieces 5’ 5’

So let’s review…

In the figure below, the 5’ end of the red strand of DNA is located towards A. The top of the slide B. The bottom of the slide

Which enzyme copies DNA during DNA replication? A. B. C. D. E. DNA ligase DNA polymerase DNA helicase DNA gyrase None of the above

Copyright © The Mc. Graw-Hill Companies, Inc. Permission required for reproduction or display. Which

A bacterial cell that had a mutation in the gene for Primase (RNA polymerase) such that the enzyme did not function would NOT be able to A. Synthesize the leading strand only B. Synthesize the lagging strand only C. Synthesize either the leading or lagging strand

Continuous replication in prokaryotes • Replication produces two copies of DNA – Each daughter cell receives one – Replication of E. coli chromosome takes ~40 minutes • Remember optimal generation time is ? • Cell can initiate new replication before previous round is complete • Each daughter cell inherits one complete chromosome already undergoing replication

Prokaryotic DNA: use, copy , share “DNA EXPRESSION”

DNA expression… and an important question… DIY Manual SELECTIVE USE Are all genes “ON” at any given time? How to Oxyg make en to ngs O 2

A few things to review • Structure of DNA • Function of DNA • Compare to RNA

DNA Review • Nucleotide • Sugar-phosphate backbone • Hydrogen bonds – A-T – C-G • 5’ & 3’ ends – 1’ C attached to base – Number away from the O

RNA Review • Nucleotides – ribose • Bases – A, U, C, G • Single stranded – But may be folded

RNA types • 3 main types – m. RNA • Carries information from DNA to ribosome – r. RNA • Part of structure and function of ribosome – t. RNA • Carries amino acids to ribosome • Decodes m. RNA

Using the DNA to make protein • Central dogma: DNA m. RNA protein • Two terms: transcription and translation • Compare this to replication io lat n s transcription n transcription Why do things this way? Why not go from DNA straight to protein?

Gene Expression: DNA m. RNA protein • http: //www. youtube. com/watch? v=41_Ne 5 m. S 2 ls&feature=related

Now the details

Transcription Terminology • Promoter – Sequence in DNA – Marks beginning of genes • Bacteria may have multiple genes after one promoter – Sigma factor recognizes promoter (Bacteria)

Transcription Terminology • RNA polymerase – Enzyme that synthesizes RNA from DNA template – Makes new RNA in 5’ to 3’ direction • Transcription Terminator – Sequence in DNA – Marks ends of genes

Copyright © The Mc. Graw-Hill Companies, Inc. Permission required for reproduction or display. 3' 5' Promoter Transcription terminator RNA polymerase INITIATION 5' 3' 3' 5' Sigma ELONGATION Template strand 5' 3' 3' Promoter 5' 5’ to 3’ direction TERMINATION 5' m. RNA GACUG C T GA C 5' 3' 3' 5' Promoter 5' Hairpin loop RNA polymerase dissociates from template.

Initiation • RNA Polymerase binds promoter • Gets oriented – Which way to go – Which strand to use • Begins opening the DNA

Elongation • Brings in complementary RNA nucleotides to the DNA nucleotides in its active site • C-G • G-C • T-A • A-U DNA RNA

Transcription – up close

Termination • RNA polymerase reaches the terminator • RNA polymerase is bumped off the DNA • Transcription ends

Transcription – in real life You need to understand what is happening in this picture Where is – the DNA template? Promoter? Terminator? Elongation happening? Why >1 m. RNA?

Transcription vs replication • RNA polymerase synthesizes RNA in 5’ to 3’ direction – Compare this to DNA polymerase – similar, different • Opens the DNA on its own – What enzyme did this in DNA replication? • Can initiate without primer – Where in replication do you see a similar enzyme used? • Binds to promoter (upstream of genes) – Where does replication machinery bind and start? • Stops at terminator (transcription ends) – Same as replication termination site? Why not?

True or false: All the information in the DNA of a cell is organized into genes that code for proteins. A. True B. False

Which of the following is the best description of the role of RNA polymerase? A. B. C. D. To translate m. RNA into protein To replicate the DNA To copy the code in the DNA into m. RNA To synthesize several types of RNA using the code in the DNA E. To degrade polymers of RNA

True or false: during the process of transcription, DNA and RNA nucleotides bind to each other by hydrogen bonds A. True B. False

Translation – reagent, product, enzyme? Figure 8. 2

Translation – what is the m. RNA language? • • • Carries DNA information translated in codons (3 nucleotides) begins at start codon: AUG ends at nonsense codons: UAA, UAG, UGA 64 sense codons encode 20 amino acids The genetic code is degenerate

Translation tables

Codons • Start codon – AUG nearest 5’ end – Codes for Met – Marks beginning – Sets reading frame • Stop codon – UAA, UAG, UGA – Marks end – No amino acid

Ended here

Ribosomes • Organizes translation – Binding sites for m. RNA, t. RNA • A site – Amino acid-t. RNA enters • P site – Growing polypeptide chain • E site – “empty” t. RNA exits • Catalyzes peptide bond formation – ribozyme

t. RNA • Carries amino acid • Decodes m. RNA – Anticodon • 3 nucleotides complementary to codon

The Process of Translation WHAT SIZE ARE THESE PIECES IN PRO v EUK? DO YOU HAVE TO KNOW THIS FOR A TEST? Figure 8. 9

The Process of Translation Figure 8. 9

The Process of Translation WHAT CHEMICAL REACTION IS THIS? Figure 8. 9

The Process of Translation Figure 8. 9

The Process of Translation CAN THIS RIBOSOME MAKE ANY PROTEIN OR ARE RIBOSOMES DEDICATED TO SUBSET RNAs? Figure 8. 9

Events - initiation • Small subunit binds to m. RNA (ribosome binding site) • Met-t. RNA binds to start codon (binds in P site) • Large subunit binds

Elongation • Amino-acid t. RNA enters A site • Ribosome catalyzes peptide bond formation • Ribosome translocates (shifts) – Growing polypeptide in P site – New codon in A site – “empty” t. RNA in E site • Repeat

Termination • Stop codon in A site • Release factor releases polypeptide chain

The process of transcription begins at A. B. C. D. E. Start codons Promoters Origins of replication Transcription initiators None of the above

During translation, ribosomes function to A. Bind the m. RNA B. Bind the t. RNA C. Catalyze bond formation between amino acids D. Both A and B are correct E. All (A-C) are correct

In the table shown below, the three letter codes such as “AUG” and “ACA” represent A. Codons in m. RNA B. Anticodons in t. RNA C. Both A and B

When m. RNA is translated, the “reading frame” is directly determined by A. The location of the start codon closest to the 5’ end of the m. RNA B. The location of the ribosome binding sequence in the m. RNA C. The reading frame initiator sequence D. All of the above are correct E. None of the above are correct

Translate the following m. RNA: 5’CGAUCAUGUUUAUAUAACACG 3’ A. Arg-Ser-Cys-Leu-Tyr-Asp-Thr B. Met-Phe-Ile C. Met-Lys-Tyr D. Ala-Ser-Thr-Asp-Ile-Leu-Cys

A cell that has a mutation such that the tryptophan-t. RNA cannot bind tryptophan would A. Be unable to initiate translation B. Be unable to make any proteins C. Be unable to complete any proteins that contain tryptophan D. Complete the synthesis of all proteins E. Complete the synthesis of all proteins, but would be missing tryptophan from these proteins

RNA Processing in Eukaryotes This applies to what groups of microbes? ? Figure 8. 11

Eukaryotes v prokaryotes genetic differences • Eukaryotes – Multiple, linear chromosomes – One promoter per gene – Topoisomerase for letting tension out of DNA – Introns/Exons • Bacteria – Single, circular chromosome – Multiple genes under one promoter (operon) – DNA gyrase (target for antibiotics) – No introns

eukaryotes v prokaryotes – consequences of the differences Eukaryote • What is the difference by definition? • Replication – Linear chromosomes – In nucleus; must wait for nucleus to divide completely • Transcription – In nucleus – m. RNA processing • Translation – In cytoplasm – Must wait for transcript to exit nucleus – 80 s ribosome Prokaryote • Replication – Single circular chromosome* – In cytoplasm; can replicate again before first round is finished • Transcription – In cytoplasm – Always available • Translation – In cytoplasm – Can simultaneously translate as transcript is being made!!! – 70 s ribosome

Major differences eukaryotes v prokaryotes Eukaryote • Nucleus • Replication Prokaryote • No nucleus • Replication • Transcription • Translation – Linear chromosomes – In nucleus; must wait for nucleus to divide completely – In nucleus – m. RNA processing – In cytoplasm – Must wait for transcript to exit nucleus – 80 s ribosome – Single circular chromosome* – In cytoplasm; can replicate again before first round is finished – In cytoplasm – Always available – In cytoplasm – Can simultaneously translate as transcript is being made!!! – 70 s ribosome

Major differences eukaryotes v prokaryotes Eukaryote • Nucleus • Replication Prokaryote • No nucleus • Replication • Transcription • Translation – Linear chromosomes – In nucleus; must wait for nucleus to divide completely – In nucleus – m. RNA processing – In cytoplasm – Must wait for transcript to exit nucleus – 80 s ribosome – Single circular chromosome* – In cytoplasm; can replicate again before first round is finished – In cytoplasm – Always available – In cytoplasm – Can simultaneously translate as transcript is being made!!! – 70 s ribosome *there are exceptions

Major differences eukaryotes vs prokaryotes Eukaryote • Nucleus • Replication Prokaryote • No nucleus • Replication • Transcription • Translation – Linear chromosomes – In nucleus; must wait for nucleus to divide completely – In nucleus – m. RNA processing – In cytoplasm – Must wait for transcript to exit nucleus – 80 s ribosome This means what in terms of speed? ? – Single circular chromosome* – In cytoplasm; can replicate again before first round is finished – In cytoplasm – Always available – In cytoplasm – Can simultaneously translate as transcript is being made!!! – 70 s ribosome

Prokaryotic world: Simultaneous Transcription & Translation CAN THIS HAPPEN IN A EUKARYOTIC CELL? Figure 8. 10

NEXT TIME: share