Bio 260 Day 10 more genetics LAST TIME

Bio 260 Day 10 – more genetics

LAST TIME: copy and use

Finish “using” the DNA • Gene “expression” DNA m. RNA protein • DNA m. RNA “transcription” • Once you make m. RNA how does that result in a protein? “translation” • Are genes always being expressed? How is that regulated? • Do genomes always stay the same? How does genetic evolution work (in bacteria? )

translation • What kind of chemistry? • Substrate? Enzyme? Product?

Ribosomes – the enzyme • Organizes translation – Binding sites for m. RNA, t. RNA • A site – Amino acid-t. RNA approaches • P site – Growing polypeptide chain • E site – “empty” t. RNA exits • Catalyzes peptide bond formation – ribozyme

t. RNA • Carries amino acid • Decodes m. RNA – Anticodon • 3 nucleotides complementary to codon

The Process of Translation Details of initiation to know are on a slide later WHAT SIZE ARE THESE PIECES IN PRO v EUK? DO YOU HAVE TO KNOW THIS FOR A TEST? Figure 8. 9

The Process of Translation Met already in place (P) Next amino acid enters (A) Figure 8. 9

The Process of Translation WHAT CHEMICAL REACTION IS THIS? Figure 8. 9

The Process of Translation Figure 8. 9

The Process of Translation The t. RNA exits in E Figure 8. 9

The Process of Translation Figure 8. 9

The Process of Translation Figure 8. 9

The Process of Translation CAN THIS RIBOSOME MAKE ANY PROTEIN OR ARE RIBOSOMES DEDICATED TO SUBSET RNAs? Figure 8. 9

Events - initiation • Small subunit binds to m. RNA (ribosome binding site) • Met-t. RNA binds to start codon (binds in P site) • Large subunit binds

Elongation • Amino-acid t. RNA enters A site • Ribosome catalyzes peptide bond formation • Ribosome translocates (shifts) – Growing polypeptide in P site – New codon in A site – “empty” t. RNA in E site • Repeat

Termination • Stop codon in A site • Release factor releases polypeptide chain

Participation points • Get out a sheet of paper and complete the following short quiz – feel free to work in pairs

The process of transcription begins at A. B. C. D. E. Start codons Promoters Origins of replication Transcription initiators None of the above

During translation, ribosomes function to A. Bind the m. RNA B. Bind the t. RNA C. Catalyze bond formation between amino acids D. Both A and B are correct E. All (A-C) are correct

In the table shown below, the three letter codes such as “AUG” and “ACA” represent A. Codons in m. RNA B. Anticodons in t. RNA C. Both A and B

When m. RNA is translated, the “reading frame” is directly determined by A. The location of the start codon closest to the 5’ end of the m. RNA B. The location of the ribosome binding sequence in the m. RNA C. The reading frame initiator sequence D. All of the above are correct E. None of the above are correct

Translate the following m. RNA: 5’CGAUCAUGUUUAUAUAACACG 3’ A. Arg-Ser-Cys-Leu-Tyr-Asp-Thr B. Met-Phe-Ile C. Met-Lys-Tyr D. Ala-Ser-Thr-Asp-Ile-Leu-Cys

A cell that has a mutation such that the tryptophan-t. RNA cannot bind tryptophan would A. Be unable to initiate translation B. Be unable to make any proteins C. Be unable to complete any proteins that contain tryptophan D. Complete the synthesis of all proteins E. Complete the synthesis of all proteins, but would be missing tryptophan from these proteins

Eukaryotes v prokaryotes genetic differences • Eukaryotes – What is the difference by definition? • Bacteria

Eukaryotes v prokaryotes genetic differences • Eukaryotes – DNA is separate from cytoplasm (nucleus) – Multiple, linear chromosomes – One promoter per gene – Introns (regions that need to be removed) • Prokaryotes (bacteria) – No nucleus – Single, circular chromosome – Multiple genes under one promoter (operon)

eukaryotes v prokaryotes – consequences of the differences Eukaryote • Replication – Multiple chromosomes separated from cytoplasm – Must wait for nucleus then cell to divide completely before next cycle of replication Prokaryote • Replication – Single circular chromosome* in cytoplasm – Do bacteria wait for replication finish before initiating next cycle? (Remember the 20’ generation time vs 40’ replication time in E. coli) *there are exceptions

eukaryotes v prokaryotes – consequences of the differences Eukaryote • Replication – Must wait for nucleus to divide completely • Transcription/translatio n – Where do these occur? – What needs to happen to get m. RNA ready? Prokaryote • Replication – Can replicate again before previous replication finishes • Transcription/translation – Where do these occur? – What needs to happen to get m. RNA ready?

eukaryotes v prokaryotes – consequences of the differences Eukaryote • Replication Prokaryote • Replication • Transcription/ translation – Must wait for nucleus to divide completely – In nucleus – m. RNA must be completely transcribed and processed and leave nucleus before translation can begin • Translation – Must wait for transcript to exit nucleus – 80 s ribosome – Can replicate again before first round is finished – Both happen in cytoplasm – m. RNA is available as soon as it begins to come out of RNA pol – m. RNA can be translated WHILE STILL BEING MADE – Other difference – what about ribosome? – 70 s ribosome This means what in terms of speed? ?

Prokaryotic world: Simultaneous Transcription & Translation CAN THIS HAPPEN IN A EUKARYOTIC CELL? Figure 8. 10

Copy, use, share – before we move onto share…

One last thing about “using” the DNA • Are all genes always made into protein all the time? • How is gene expression regulated (in bacteria)?

Prokaryotic Gene Regulation • Homeostasis – Cells respond to their environment by • Regulating their chemistry – Cells regulate their chemistry by • Regulating their enzymes

Ways to regulate enzymes • At the protein level • At the gene level

WHAT KIND OF REGULATION IS SHOWN ON TOP? What’s more efficient? Inhibit every enzyme or just one? And if so which one? Eg. Trp synthesis HOW CAN WE ACHIEVE THE BOTTOM KIND? Which is more efficient? Regulate transcription of each enzyme individually or as a group?

Prokaryotic Gene Regulation • Enzyme regulation – Activity (protein level) • Feedback inhibition (NONCOMPETITIVE) – Transcription (gene level) • When a gene is being transcribed and its gene product is present in the cell, the gene is being “expressed” or is “on”

Prokaryotes organized DNA into operons – several genes share a control region – access to promoter controls access to genes – genes regulated together Genes for proteins Control sequence Promoter Operator A B C

Principles of Regulation • Constitutive Enzymes – enzymes that are made all the time – such as? • Regulated Enzymes – enzymes that are made in response to changes in the cell’s environment – examples?

Regulation terminology • Constitutive genes are “ON” all the time • Regulated genes are expressed only as needed – Repressible genes – Inducible genes – Catabolite repression

An example of regulated Enzymes required for lactose metabolism Glucose, monosaccharide is ideal C source ONLY induced when lactose PRESENT, glucose ABSENT

A few more terms • Gene: instruction for making protein – two pieces – promoter (when-to-make) + coding (how-to-make) • Coding sequence – Sequence in m. RNA read by ribosome protein • Promoter: – Regulatory sequence; RNA pol binds to begin transcription • Operon: – series of genes controlled by the same promoter • Operator: – regulatory sequence near the promoter • Repressor – Nearby gene protein that inhibits transcription by binding operator

Repressors • Allosteric DNA-binding proteins – DNA-binding site binds to Operator – Allosteric sites for control molecules – Binding at allosteric site changes repressor shape • Block transcription – Negative control

Repressors prevent transcription If we want transcription to take place what must happen?

Example of an operon Figure 8. 13

Repressible, inducible • Repressible – want these on by default – turn OFF when not needed – Eg. Synthesizing amino acids (Tryptophan) • Inducible – only need them sometimes – turn them ON only when needed – Eg. Metabolizing unusual carbon sources (lactose)

Determined by the type of repressor • Two types of repressors and operons – Repressible operons • Repressor alone is inactive • Co-repressor binds and activates the repressor – Inducible operons • Repressor is active alone • Inducer binds and de-activates the repressor

The trp operon • Anabolic operon • Genes for enzymes to make tryptophan (amino acid) • E. coli can make its own trp from glucose plus nitrogen, but this costs energy • If trp is in E. coli’s food, why bother making its own?

The trp operon • • Promoter Operator Five structural genes Controlled by trp repressor – Gene is outside the operon – Constitutively expressed – Produced in inactive form

predict • Is Trp essential? (what if you didn’t have it? ) • Do you want Trp ON all the time? • Do you want it OFF by default with the option of turning it ON OR leave it ON by default and turn it OFF when not needed • HINT: repressor is usually INACTIVE • Is this repressible or inducible?

The trp operon • When tryptophan is absent – The repressor is – Transcription is • When tryptophan is present – The repressor is – Transcription is

An example of repressible genes Normally Trp synthesis genes are ON Figure 8. 13

Repressing genes (levels are high) Figure 8. 13

Let’s compare to the lac operon Enzymes required for lactose metabolism Glucose, monosaccharide is ideal C source ONLY induced when lactose PRESENT, glucose ABSENT

Lactose metabolism review Bring lactose IN to the cell Chop lactose into monosaccharides (THEN what happens to glucose? )

Lac operon proteins Gene lac. Z lac. Y lac. A lac. I Product Beta-gal; splits lactose into glucose/galactose (so it’s what kind of polysaccharide? ) lactose permease; brings lactose into the cell don’t worry about this one lac repressor; CONSTITUTIVE, nearby outside; normally ACTIVE binds lac operator

Normally the lac operon is repressed - why? Figure 8. 12

But it is inducible (specific conditions) Figure 8. 12

The effect of lactose • Lactose absent – Repressor active – Binds operator – Blocks access to promoter • Lactose present – Lactose binds repressor – Inactive repressor can’t bind operator – Promoter is accessible

Is it really that simple • Of COURSE NOT • Remember: lactose operon ON only when lactose present AND glucose absent

The effect of lactose • Lactose absent – Repressor active – Binds operator – Blocks access to promoter • Lactose present – Lactose binds repressor – Inactive repressor can’t bind operator – Promoter is accessible

Is it really that simple • Of COURSE NOT • Remember: lactose operon ON only when lactose present AND glucose absent

Activators—Positive Control • Bind to DNA control regions – Activator-binding sites near promoters • Enhance ability of RNA polymerase to bind – Positive control of transcription

Lactose operon needs activator also CAP-bs Promoter Operat. Z Y A

CAP is an activator • Catabolite activator protein (CAP) is an activator of many catabolic operons – E. coli preferentially uses glucose – when glucose is low, need enzymes to use other carbon sources

How CAP works • CAP is controlled by cyclic AMP (c. AMP) – binds and activates CAP – When glucose is high, c. AMP is low • So CAP will be ? • Will it be available to bind activate lac operon? – When glucose is low, c. AMP is high • CAP will be ? Consequence to lac operon?

Catabolite Repression (a) Growth on glucose or lactose alone (b) Growth on glucose and lactose combined Figure 8. 14

• Lactose present, no glucose • Lactose + glucose present Figure 8. 15

The graph to the right shows the growth curve of E. coli when it is grown in media containing glucose and lactose. The correct phases of growth in this curve are A. Lag, log, stationary, log B. Lag, log, lag, log C. Stationary, log, stationary, log

Which of the following is correct for the time marked “A” on the graph? A. Lactose is bound to the repressor, c. AMP-CAP is not bound to the CAP binding site, B-galactosidase is not being made B. Lactose is bound to the repressor, c. AMP-CAP is bound to the CAP binding site, B-galactosidase is being made C. Lactose is not bound to the repressor, c. AMP-CAP is not bound to the CAP binding site, B-galactosidase is not being made D. Lactose is not bound to the repressor, c. AMP-CAP is bound to the CAP binding site, B-galactosidase is being made

Which of the following is correct for the time marked “B” on the graph? A. Lactose is bound to the repressor, c. AMP-CAP is not bound to the CAP binding site, B-galactosidase is not being made B. Lactose is bound to the repressor, c. AMP-CAP is bound to the CAP binding site, B-galactosidase is being made C. Lactose is not bound to the repressor, c. AMP-CAP is not bound to the CAP binding site, B-galactosidase is not being made D. Lactose is not bound to the repressor, c. AMP-CAP is bound to the CAP binding site, B-galactosidase is being made

If an E. coli cell had a mutation in the Lac repressor protein such that it could not bind lactose, then A. The mutant cells would make Bgalactosidase when grown in lactose only, but not when grown in glucose only B. The mutant cells would make Bgalactosidase when grown in glucose only, but not when grown in lactose only C. The mutant cells would always make Bgalactosidase D. The mutant cells would never make Bgalactosidase

Lac vs. Trp Lac operon Trp operon • ______operon (breaks down food) • The environmental signal (lactose) acts as_____ • All by itself, the repressor is _______ • Example of an inducible operon • ______ operon (makes a building block) • The environmental signal (tryptophan) acts as _____ • All by itself, the repressor is ______ • Example of a repressible operon

Now that we know how to use the DNA • Changing the DNA – Mutation – Transduction – Conjugation – Transformation

Change in DNA can change protein Are they all visible? What is a Mutation? Are they all bad?

Mutation • • A change in the genetic material Mutations may be neutral, beneficial, or harmful Mutagen: Agent that causes mutations Spontaneous mutations: Occur without mutagen

“CENTRAL DOGMA” of Molecular Biology: DIY Manual How to Oxyg make en to ngs O 2

“CENTRAL DOGMA” of Molecular Biology: DIY Manual “TYPO” in DNA changes protein How to Oxyg make en to ngue s O 2

Mutation may be beneficial (especially for microbes) • Environment changes microbes adapt • Natural selection favors those with greater fitness • How to adapt • Change when genes turned ON and OFF (mutate regulatory DNA or proteins) • Change the available genes (mutate or acquire change or add proteins) • Change in organism’s DNA alters genotype • Sequence of nucleotides in DNA • Bacteria are haploid, only one copy • May change observable characteristics, or phenotype • Also influenced by environmental conditions

Change in phenotype • Genetic change can affect organism’s phenotype – Deletion of gene for tryptophan biosynthesis yields mutant that only grows if tryptophan supplied • Growth factor required – Changing target of antibiotic or adding gene for antibiotic resistance (and others) • can survive antimicrobial treatment

Mutation • Point mutation – change in one base • Missense mutation – point mutation that results in changed amino acid Figure 8. 17 a, b

Mutation • Nonsense mutation - Results in a stop codon Figure 8. 17 a, c

Mutation • Frameshift mutation - Insertion or deletion of one or more nucleotide pairs Figure 8. 17 a, d

How often does this happen? • Spontaneous mutation rate = 1 in 109 replicated base pairs or 1 in 106 replicated genes • Mutagens increase to 10– 5 or 10– 3 per replicated gene

How do we get there? • Chemicals • Radiation

Chemical Mutagens Figure 8. 19 a

Radiation • Ionizing radiation (X rays and gamma rays) causes the formation of ions that can react with nucleotides and the deoxyribosephosphate backbone

Radiation • UV radiation causes thymine dimers Figure 8. 20

Repair • Photolyases separate thymine dimers (in light) • Nucleotide excision repair Figure 8. 20

How do we detect it? How would you isolate an antibiotic-resistant bacterium? An antibiotic-sensitive bacterium? How can you test chemicals to see what their effects might be?

Selection • Positive selection – detects mutant cells because they grow or appear different • Negative selection – detects mutant cells because they do not grow – Replica plating

Replica Plating Figure 8. 21

Ames Test for Chemical Carcinogens Figure 8. 22

Changing the DNA - in prokaryotes this includes “sharing” • Changing the DNA – Mutation – Transformation – Conjugation – Transduction

Horizontal vs. vertical gene transfer

Getting us back to THIS question • E. coli is found naturally in human colon, and there it is beneficial. However, the strain designated E. coli O 157: H 7 produces Shiga toxin. How did E. coli acquire this gene from Shigella?

How genes are transmitted • Vertical gene transfer: Occurs during reproduction between generations of cells • Horizontal gene transfer: The transfer of genes between cells of the same generation (acquire from other cells)

Horizontal gene transfer occurs naturally by 3 mechanisms • Transformation: naked DNA uptake by bacteria • Conjugation: DNA transfer between bacterial cells • Transduction: bacterial DNA transfer by viruses

Same basic mechanism: Genetic Recombination Figure 8. 25

Genetic Transformation Figure 8. 24

Bacterial Conjugation Figure 8. 26

Conjugation in E. coli Figure 8. 27 a

Conjugation in E. coli Figure 8. 27 c

Plasmids • Conjugative plasmid: – Carries genes for sex pili and transfer of the plasmid • Dissimilation plasmids: – Encode enzymes for catabolism of unusual compounds • R factors: – Encode antibiotic resistance

Transduction by virus (eg. Bacteriophage) Figure 8. 28

Clinical application • E. coli is found naturally in human colon, and there it is beneficial. However, the strain designated E. coli O 157: H 7 produces Shiga toxin. How did E. coli acquire this gene from Shigella? Naked DNA uptake (transformation)? Conjugation? Transduction?

Clinical application • Shiga toxin is one of the most potent toxins known to man; CDC lists it as a potential bioterrorist agent It seems likely that DNA from Shiga toxin-producing Shigella bacteria was transferred by a bacteriophage to otherwise harmless E. coli bacteria, thereby providing them with the genetic material to produce Shiga toxin act to inhibit protein synthesis within target cells by a mechanism similar to that of ricin. After entering a cell, the protein cleaves a specific adenine from the 30 S RNA of the 60 S subunit of the ribosome, thereby halting protein synthesis.

If a cell of one organism gets a piece of DNA from the cell of a different organism, what could happen? A. The cell that receives the DNA might make a new protein. B. The cell that receives the DNA might behave differently. C. The phenotype of the cell that receives the DNA might change. D. All of the above are possible. E. Nothing. The DNA will be too different.