Bellringer Chemical structures that are involved in physiological

Bellringer Chemical structures that are involved in physiological processes, such as hemoglobin in blood, insulin that regulates blood glucose levels, and enzymes that regulate body functions, are all made of proteins. Name some parts of the human body that contain proteins.

Key Ideas What is the process of gene expression? What role does RNA play in gene expression? What happens during transcription? How do codons determine the sequence of amino acids that results after translation? What Do are the major steps of translation? traits result from the expression of a single gene?

Objectives: Transcription & Translation Today: Describe gene expression Explain the role of RNA in gene expression Summarize transcription Tomorrow: Explain how codons determine the amino acid sequence of a protein Describe the steps of translation Identify a complexity of gene expression

Gene Expression How we get from DNA to traits.

Vocabulary RNA Gene expression Transcription Translation Codon

An Overview of Gene Expression So far, we’ve discussed the structure of DNA… being made of nucleotides that contain 1 of 4 different nitrogenous bases. You should know that DNA’s job is to store genetic information. You’ve also learned the cell cycle. We’ll be spending the next few days on G 1 of the cell cycle. This is the phase where most of “living” takes place. It’s the phase that proteins and traits are made.

The Purpose of DNA… The purpose of DNA itself is to house the information necessary for heritable traits…meaning that it holds the information from which proteins are made. This is what living is all about. The DNA in our chromosomes is like books on the shelf of a library… just waiting to be read. DNA provides the original information from which proteins are made in a cell, but DNA does not directly make proteins. The Purpose of Life

An Overview of Gene Expression, � Gene expression is the manifestation of genes (contained in DNA) into specific traits. � What does manifestation mean? � THE CENTRAL DOGMA OF BIOLOGY = � DNA m. RNA Protein Trait � This process takes place in two main stages, 1. Transcription: the process of copying the 2. directions for traits out of DNA by making m. RNA Translation: reading the directions copied in RNA and turning them into the amino acid sequences for the gene.

THE CENTRAL DOGMA OF BIOLOGY Directions to make HAIR COLOR ACTGAACTGCACTG… DNA RNA PROTEIN TRAIT

R LO O C IN E K R S A r fo U s O n Y o cti LL e A r i T D OW H for s ES ion L t K c C E Dire R R or F LO f s O on i t EC c Y e r E R Di LO for O s C ion R t I c A r. H Dire o f s ion t c Dire Genes: The basic units of heredity. They are located on specific regions of chromosomes, contained in DNA. There are thousands of genes “written” into each of the 23 chromosomes in our cells. They come from the original genes given to us from mom & dad.

So What Does a Real Gene Look Like? Pro-melanin-concentrating hormone tacagcgtgt ggcattctcc ccacattctc cttcggcttt acggagcagc aaacaggatg gcgaagatga gcctctcttc ctacatgtta atgctggcct tttctttgtt ttctcacggc attttacttt cggcctccaa gtccatcagg aacgtagaag cgacatagt atttaataca ttcaggatgg ggaaagcctt tcagaaggaa ataccgcagaagatcggt tgttgctcct tctctggaag gatacaaaaa tgatgagagc ggcttcatga aggatgaaga tgacaagacc acaaaggtac gtgtatgcag tctgcctttt attgcactag agatgaaaac gatgtttaca attataagcc acccagaagt aaattttgta ttttaatttt ataaataggc tacag tcattgtgtg tattaagata actaggaaaa cgtcatacaa accaggcatt tccccattct atccagaatc ttgtatcttg tctcgcatat ggaggtaaag acagtataca gcatcttaga actgatcagc aagaatgttg tacaactgta ttctagctct actctgaaga agacagctgg gatacaaacc aatcttctct tcacagaaca caggctccaa gcagaatctc gtaactcacg gtctgcccct cagtctggct gtaaaacctt acctcgctct gaaaggacca gcagtcttcc cagctgagaa tggagttcag aatactgagt ccacacagga aaagagggaa attggggatg aagaaaactc agctaaattt cccataggaa ggagagattt tgacagtgag tagccttcta aacatgcaat tcctacatat taattttata aaagagctct gagcttcact gagttggatc tgaccataac aaaatcaaga ccatagttca gttctatcaa atagtaggca gcccacgtca aaatggggaa tttttcaaaa tcagtaatag tggttt tattctggat tcattataag tccacagatt ctcttaattc tgtgtggtaa ttatagtcat tgttcc ttttcagtgc tcaggtgtat gctgggacga gtctaccgac cctgttggca agtctgatac ctgctggtcc acaacatcct ttcagaagaa aacgattcat tgcaagtgga gagaaaagcc cttaatgttg atgtaacttg tgtatcatcc taaatgtctg ttttaaaaga aactggttac aatatgtaaa tgctatgtaa atgatatgct ttgacttgtg cattaaactt cacaaaaatt ctgcata -http: //www. ncbi. nlm. nih. gov/gene/24659#reference-sequences

Hemoglobin Gene TACCACGACAGAGGACGGCTGTTCTGGTTGCAGTTCCGGC GGACCCCGTTCCAACCGCGCGTGCGACCGCTCATACCACG CCTCCGGGACCTCTCCTACAAGGACAGGAAGGGGTGGTGG TTCTGGATGAAGGGCGTGAAGCTGGACTCGGTGCCGAGAC GGGTCCAATTCCCGGTCCGTTCTTCCACCGGCTGCGCGACT GGTTGCGGCACCGCGTGCACCTGCTGTACGGGTTGCGCGA CAGGCGGGACTCGCTGGACGTGCGCGTGTTCGAAGCCCAC CTGGGCCAGTTGAAGTTCGAGGATTCGGTGACGACC ACTGGGACCGGCGGGTGGAGGGGCGGCTCAAGTGGGGAC GCCACGTGCGGAGGGACCTGTTCAAGGACCGAAGACACTC GTGGCACGACTGGAGGTTTATGGCAATTCGACCTCGGAGCC ATCGTCAAGGAGGACGGTCTACCCGGAGGGTTGCCCGGGA GGAGGAACGTGGCCGGGAAGGACCAGAAACTTATT TCAGACTCACCCGCCG http: //www. bio. davidson. edu/courses/Bio 111/Hemomut. html

Gene Transcription and Translation Where Does it Occur?

RNA: A Major Player All of the steps in gene expression involve RNA. What exactly is RNA, & how does is compare to DNA? First, like DNA, RNA is a nucleic acid made of nucleotide subunits linked together.

RNA vs. DNA �RNA is a nucleic acid like DNA �But RNA differs from DNA in 3 ways. 1. 2. 3. First, RNA usually is composed of one strand of nucleotides rather than two strands. a. The exception occurs in viruses Second, RNA nucleotides contain the fivecarbon sugar ribose rather than the sugar deoxyribose. Third, RNA nucleotides have a nitrogenous base called uracil (U) instead of the base thymine (T). a. Uracil (U) is complementary to adenine (A) whenever RNA pairs with another nucleic acid.

DNA vs RNA Structure Deoxyribose DNA ◦ Is missing one oxygen in the ribose sugar. Ribose ◦ Nucleic Acid = RNA Has all oxygens

Visual Concept: Ribonucleic Acid (RNA)

RNA: A Major Player In cells, three types of RNA complement DNA and translate the genetic code into proteins. 1. Messenger RNA (m. RNA) is produced when DNA is transcribed into RNA. The m. RNA carries instructions for making a protein from a gene and delivers the instructions to the site of translation.

RNA: A Major Player 2. Transfer RNA (t. RNA) “reads” the instructions carried by the m. RNA at the site of translation, then translates the m. RNA sequence into protein subunits called amino acids. 3. Ribosomal RNA (r. RNA) is an RNA molecule that is part of the structure of ribosomes. Recall from CH 7, ribosomes are the cellular structure where protein production occurs.

Objectives Define Transcription Summarize the steps of transcription Step 1 2 3 In order to help keep this straight, make a chart like the one below. Major events

Transcription: Reading the Gene Transcription Steps 1. Transcription begins when RNA polymerase binds to the specific DNA sequence in the gene that is called the promoter. - The promoter’s role is to signal the RNA polymerase where to start transcription. The DNA always contains the sequence TAC for the “start” signal.

Transcription: Reading the Gene 2. RNA polymerase then unwinds and separates the two strands of the DNA double helix to expose the DNA bases on each strand.

Transcription: Reading the Gene, 3. RNA polymerase moves along the bases on the DNA strand adds complementary RNA nucleotides to a growing m. RNA as it “reads” the DNA of the gene until it reaches the “stop” signal. Remember that in transcription “U” matches with “A”, not “T” like in replication. - - The “A” still matched to “T” though. As RNA polymerase moves down the DNA strand, a single strand of m. RNA grows. Just as there is a “start” signal on the DNA, signaling the start of the gene, there is a “stop” signal as well. This region is specially designed to let the RNA polymerase know when the gene ends & therefore when to stop transcription. This stop signal is one of 3 DNA sequences: ATT, ATC, or ACT. What would the RNA sequences be? UAA, UAG, or UGA

Visual Concept: Transcription

Transcription

Review A gene is similar to a recipe. Gene expression is like the process of baking a secret cake recipe, complicated because the recipe is written in a language the chefs don’t understand. It is written as one long sentence composed of just one word. The word is written in the language of the nitrogenous bases, A, T, G, &C A gene is written in a unique language that must be transcribed by a messenger that speaks the language of the chefs. The way the recipe is delivered to the chefs (the ribosomes) in the cytoplasm (the bakery) is by the messenger “m. RNA”. m. RNA copies the recipe during transcription and delivers it to the bakery in the cytoplasm for translation to occur (decoding the recipe in a different language to allow for baking the recipe). In the cytoplasm the recipe is translated into the language of proteins (amino acids) and finally made into proteins. Finally, the secret cake is made. Now it’s your turn to read the recipe.

Practice Transcription…making an m. RNA complement to the gene in DNA= TCTACAGGAGCGCTGGCAAGACTGCCG RNA= You make it. Examine the DNA sequence above. Look through and identify the promoter region containing the “start signal” of DNA. Underline it. Do the same for the “stop signal”. Write an RNA sequence of bases using the complement to the entire DNA sequence using the RNA bases (A-U-C-G), starting with the sequence of the “start” site all the way until you reach one of the 3 “stop” sequences. Only write the RNA sequence that complements the DNA sequence from the “start” to “stop” signals. You have 5 minutes. Ask questions if you need to.

DNA: Practice… TCTACAGGTGCAAGACTGCCG m. RNA: o Find the start sequence…underline it. o Find the stop sequence…underline it. o Starting with the start sequence, transcribe the gene using the RNA bases. o What you end up with is an m. RNA transcript of the gene contained in the DNA.

In-class Exercise/HW Practice Transcribing: You’re going to play the role of the messenger now. You need to be able to take a DNA sequence and identify the m. RNA that will “copy” the recipe, the gene for a protein, so the recipe can be made by the ribosomes. Gene Xlr 23: CGAACCTACAGTTCCGCGTCGGGCTAGACTGGCAATG Copy this sequence down on a sheet of paper. 2. Identify the “start” sequence within the DNA above (underline it). 3. From the start sequence, count in groups of three until you reach one of the three “stop” signals. 4. What is the “stop” sequence (underline it). 5. Just below the DNA sequence you copied, transcribe the DNA into a sequence of m. RNA for the gene Xlr 23. Tomorrow we will use this sequence to practice translation. 1.

Reflections What did you learn today? Design an acronym of pneumonic device to remember the types of RNA and steps in transcription.

In-class Exercise/HW Practice Transcribing: You’re going to play the role of the messenger now. You need to be able to take a DNA sequence and identify the m. RNA that will “copy” the recipe, the gene for a protein, so the recipe can be made by the ribosomes. Gene Xlr 23: CGAACCTACAGTTCCGCGTCGGGCTAGACTGGCAATG Copy this sequence down on a sheet of paper. 2. Identify the “start” sequence within the DNA above (underline it). 3. From the start sequence, count in groups of three until you reach one of the three “stop” signals. 4. What is the “stop” sequence (underline it). 5. Just below the DNA sequence you copied, transcribe the DNA into a sequence of m. RNA for the gene Xlr 23. Tomorrow we will use this sequence to practice translation. 1.

Objectives Day 2 Explain how codons determine the amino acid sequence of a protein Describe the steps of translation Identify a complexity of gene expression This is a short lecture so stay focused.

The Genetic Code: Three-Letter “Words” � DNA What is the m. RNA you decoded for gene Xlr 23? TACAGTTCCGCGTCGGGCTAGACTGG m. RNAA U G U C A A G G C A G C C C G A U C U G A ◦ � � What do you notice that is similar about the start and stop sequences? There is significance in the number 3 in RNA. ◦ � Save this and we’ll move on… It corresponds to what’s called a codon. A codon is a three-nucleotide sequence in m. RNA.

The Genetic Code: Three-Letter “Words” A codon is a key that corresponds to 1 of 20 amino acids. An amino acid is the building block of a protein. Codons also act as the start or stop signal for translation. These “signals” are referred to as “start” and “stop” codons on m. RNA in genetics. So the start codon is…AUG (signals the start of the gene) The stop codons are… UAA, UGA, UAG (signals the end)

DNA, RNA, and Proteins Section 3

The Genetic Code: Three-Letter “Words” Refer to you handout. There are 64 m. RNA codons. The m. RNA that is created in transcription is actually a collection of a series of 3 -nucleotide sequences called codons. So each gene will contain nucleotides in multiples of 3

The Genetic Code: Three-Letter “Words” �Your practice from last night… AUGUCAAGGCGCAGCCCGAUCUGA AUG-UCA-AGG-CGC-AGC-CCG-AUCUGA that the length of the gene is a �Notice multiple of 3… �This is the way all genes are…in multiples of 3. �This is why I asked you to count by threes until you reached the “stop” codon.

The Genetic Code: Three-Letter “Words” Each codon specifies for only one amino acid, but several amino acids have more than one codon. See leucine This system of matching codons and amino acids is called the genetic code. The genetic code is based on codons that each represent a specific amino acid. This is the translation tool that helps to translate the m. RNA from the nucleotide language into the language of amino acids.

Figure 13. The amino acid coded be a specific m. RNA codon can be determined by following the three steps below. What amino acid does the codon GAA code for? Codons in m. RNA

Translation: RNA to Proteins Translation is the process that changes the m. RNA molecule into the complementary amino acid sequence. Takes place in the cytoplasm occurs in a sequence of 5 steps Involves all three kinds of RNA and results in a complete polypeptide.

Translation: RNA to Proteins Translation relies upon the t. RNA molecule to act as the go-between for m. RNA codon & the amino acid that corresponds to it. There is only one specific amino acid for each codon. The m. RNA gets matched up with the right t. RNA molecule because of the anti-codon region An anticodon is a three-nucleotide sequence on t. RNA that is complementary to an m. RNA codon.

There are two important regions of a t. RNA. The area where the amino acid attaches & The anticodon region, which is complementary to the codon of m. RNA The anticodon always decides which amino acid is carried. AMINO ACID GOES HERE t. RNA matches m. RNA here

The Steps to Translation

Translation: RNA to Proteins, Step 1 A ribosome attaches to the m. RNA The UAC (methionine) t. RNA attaches to the start codon on m. RNA within the ribosome. Step 2 The t. RNA molecule that has the correct anticodon and amino acid binds to the second codon on the m. RNA. A peptide bond then forms between the two amino acids, and the first t. RNA is released from the ribosome.

Translation: RNA to Proteins, Step 3 The ribosome then moves one codon down the m. RNA, kicking the 1 st t. RNA out. The amino acid chain continues to grow as each new amino acid binds to the chain and the previous t. RNA is released. Step 4 This process is repeated until one of three stop codons is reached. A stop codon does not have an anticodon, so protein production stops.

Translation: RNA to Proteins, Step 5 The newly made polypeptide falls of the ribosome, the t. RNA leaves the ribosome, & the ribosome falls apart. Translation is complete & the polypeptide is free to go get processed into a protein in either the ER or the Golgi. This is where translation ends but it doesn’t have to be the only protein made. Repeating Translation Many copies of the same protein can be made rapidly from a single m. RNA molecule because several ribosomes can translate the same m. RNA at the same time.

Translation: RNA to Proteins

PEPTIDE BOND FORMS: Then the ribosome moves forward Methionine RIBOSOME Anticodon UAC m. RNA AUG UCA AGG CGC AGC CCG AUC UGA Start Codon Alw Sta amino codons ays Other rt the trigger Codon s t. RN : A fo the at tr rm eth action ine. of Stop Codon

Methionine Serine Anticodon m. RNA UAC AGU AUG UCA AGG CGC AGC CCG AUC UGA

PEPTIDE BOND FORMS: Then the ribosome moves forward Methionine Serine The growing chain of amino acids is a polypeptide, or in other words…a protein Anticodon m. RNA AGU AUG UCA AGG CGC AGC CCG AUC UGA

PEPTIDE BOND FORMS: Then the ribosome moves forward Methionine Serine Anticodon m. RNA ? UCC AUG UCA AGG CGC AGC CCG AUC UGA

PEPTIDE BOND FORMS: Then the ribosome moves forward Methionine Serine Anticodon m. RNA ? ? GCG AUG UCA AGG CGC AGC CCG AUC UGA

PEPTIDE BOND FORMS: Then the ribosome moves forward Methionine Serine Anticodon m. RNA ? ? ? UCG AUG UCA AGG CGC AGC CCG AUC UGA

PEPTIDE BOND FORMS: Then the ribosome moves forward Methionine Serine Anticodon m. RNA ? ? GGC AUG UCA AGG CGC AGC CCG AUC UGA

Methionine Serine Anticodon m. RNA ? ? ? UAG AUG UCA AGG CGC AGC CCG AUC UGA Once the stop codon is reached translation terminates. There is no t. RNA for the stop codon so the ribosome know to detach. The newly formed polypeptide then leaves to get processed.

Complexities of Gene Expression � The relationship between genes and their effects is complex. Despite the neatness of the genetic code, every gene cannot be simply linked to a single outcome. � Some genes are expressed only at certain times or under specific conditions. � Variations and mistakes can occur at each of the steps in replication and expression. � The final outcome of gene expression is affected by the environment of the cells, the presence of other cells, and the timing of gene expression.

Summary Gene expression produces proteins by transcription and translation. This process takes place in two stages, both of which involve RNA. In cells, three types of RNA complement DNA and translate the genetic code into proteins. During transcription, the information in a specific region of DNA (a gene) is transcribed, or copied, into m. RNA.

Summary, continued The genetic code is based on codons that each represent a specific amino acid. Translation occurs in a sequence of steps, involves three kinds of RNA, and results in a complete polypeptide. The relationship between genes and their effects is complex. Despite the neatness of the genetic code, every gene cannot be simply linked to a single outcome.

In Class Exercise CGAACCTACAGTTCCGCGTCGGGCTAGACTGGCAATG AUGUCAAGGCGCAGCCCGAUCUGA Complete the Gene. Translation is the last step of gene expression as it forms the final polypeptide. Your exercise today is to take the gene we transcribed into m. RNA yesterday and translate it into a polypeptide. Write your polypeptide as a series of circles with the name of the corresponding amino acid within. This is the protein for the gene you transcribed. Methionine ? ? ? Check these off with me to make sure you got it… Tomorrow you’ll have to transcribe & translate a much bigger gene.

How are you progressing? Answers to IC/HW Exercise m. RNA M e in on hi et = AUGUCAAGGCGCAGCCCGAUCUGA Poly peptide chain = Serin e Arginine Serine Pro line Isoleucine Homework

Now onto the Transcription/translation Exercise… Grab a ¼ sheet with the assignment “Using the Genetic Code” This is CW/HW and it’s due tomorrow. It’s worth 25 pts “Assignments” Tomorrow you’ll use this knowledge to transcribe and translate another gene.

Transcription/Translation Lab Working with a partner, analyze the gene Xlr 24 to determine the DNA sequence of the gene, the sequence of the m. RNA, and the sequence of the amino acids that will form the polypeptide. Answer the associated questions. This is a 100 pt lab due next Monday.