Basic Biology Review Human Body Organization Levels 1
Basic Biology Review
Human Body Organization Levels 1. Chemical 2. Cellular 3. Tissue 4. Organ 5. Organ System 6. Organismic
Chemical Level • Elements • H • C • O • Compounds • Na. Cl • KCl • Ions • Na+ • K + • Cl • Ca++ • Mg++ • Molecules • O 2 • C 6 H 12 O 6 • Macromolecules • Proteins • amino acids • Lipids • fatty Acids • Carbohydrates • monosaccharides • Nucleic Acids • nucleotides
Cellular Level Chromatin
Tissue Level • Epithelial Tissue • Connective Tissue • Muscular Tissue • Nervous Tissue
Organ Level Gastrointestinal Tract 1. Mouth 2. Pharynx 3. Esophagus 4. Stomach 5. Small Intestine 6. Large Intestine Accessory Structures 1. Teeth 2. Tongue 3. Salivary Glands 4. Liver 5. Gallbladder 6. Pancreas
Organ System Level
Organismic Level Darwin sails around the world and in South America is puzzled by the absence of rabbits. Instead he finds these rabbit-like Patagonian Hares or Mara (Dolichotis patagonum) that are not rabbits but have similar characteristics as rabbits. He postulates that they must have evolved just like rabbits because of their similar environments
Animal Cell Chromatin
DNA (deoxyribonucleic acid) Bases/Base Pairs Nucleotides 1. 2. 3. Nitrogenous Base Pairs: A–T C–G
DNA Organization • Chromatin organized: • DNA • Histones One Duplicated Chromosome
Human Chromosomes A Pair of Duplicated Chromosomes Autosomes Sex Chromosomes 46 individual chromosomes / 23 pairs of chromosomes • they are the same - code for same type of trait • they are different - code for different version of trait
Understanding the Numbers • 1 chromosome is 1 large DNA molecule • a gene is a specific sequence of nucleotides ATTCCGTAGCTGATCGTAAAGGG • 1000 -2000 genes per chromosome • ~25, 000 - 30, 000 genes per human genome
DNA Functions • Pass on Genetic Material • Replication • Mitosis • Meiosis • Protein Synthesis • Transcription • Translation
Mitosis
Replication • Making an exact copy of DNA • Occurs just prior to cell division • Double helix unwinds • DNA polymerase adds bases • Two exact copies are made
Embryongenesis - Week 1 Blastocyst Inner Cell Mass (Embryonic Stem Cells) Pluripotent Stem Cells
Embryogenesis Week 2 Embryonic Germ Cell Layers: • Endoderm • Mesoderm • Ectoderm Multipotent Stem Cells
Cell Migration Growth Cone
Radial Glia • Act like scaffolding to assist movement of neurons during development
Guide Posts Intermediate targets that help guide or direct the growth cone of the migrating cell in the proper direction
Chemotropism Target Cell or Tissue Target tissues or cells can release chemicals that will attract the specific growth cones of migrating cells.
Differentiation
Schizophrenia Abnormality Hippocampal Pyramidal Cell Disorganization
Neurobehavioral Hypothesis • Maternal/Fetal Evidence: • extensive maternal bleeding • prolonged labor • delivery complications • low birth weight • low head circumference • body length: body weight • multiparity • Anectodal Evidence • Dutch births during WWII • Season of birth effect • higher for winter pregnancies • parallel with virus exposure
Protein Synthesis • Transcription • DNA to m. RNA • Translation • m. RNA to Protein
From Gene to Protein DNA RNA Protein
Genetic Code Codons three base code Code for specific amino acids
Point Mutation Spontaneous Mutation Environmental Insult • Mutagenesis • Carcinogenesis Mutation is corrected
Point Mutation is not corrected Mutation is corrected
Sickle-Cell Anemia Mutation
Sickle-Cell Anemia Mutation
Two-Hit Hypothesis Born with 2 genes or alleles for any given disease: • one from mom • one from dad If one is bad, this increases your chance of getting the disease
Cancer in Women
Lung Cancer
- Slides: 35