An Introduction to DNA microarrays Rebecca Fry Ph
An Introduction to DNA microarrays Rebecca Fry, Ph. D. (and Leona Samson) http: //www. buffalo. edu/UBT
What is a DNA Microarray? genes or gene fragments attached to a substrate (glass) Tens of thousands of spots/genes =entire genome in 1 experiment A Revolution in Biology Hybridized slide Two dyes Image analyzed
m. RNA Analysis Methods l Northern Blot (Single Gene analysis) l Microarray Technology (Genome Wide Experiment)
NORTHERN BLOTS • m. RNAs separated on gel according to size • m. RNAs transferred to a membrane and hybridized with small number (1 -5) of radioactively labeled DNA probes. • Probe corresponds to gene of interest • Target RNA is spatially fixed and the labeled probe is in solution • Low throughput
i. e. , your cloned gene(s)
Number of Genes in Different Organisms Human ~ 30, 000 genes Yeast ~ 6200 genes Mouse ~ 30, 000 genes E. coli ~ 4200 genes Phage T 4 ~ 200 genes Influenza ~ 12 genes
i. e. , your cloned gene(s) We could just 35, 000 Northern to monitor expression of all genes!!!
Northern Blots Immobilized m. RNA population hybridized with labeled probe representing one gene DNA Microarrays Immobilized probes hybridized with labeled m. RNA population representing all expressed genes
Need to achieve two things: (i)Immobilize thousands of probes specific for individual genes (ii)Label m. RNA populations
Designing Oligo Probes 846 1 EGFP ORF ATTCTGCAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCACCATG GTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGA GCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCG GCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGC GTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCA AGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGG ACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACC CTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAAC ATCCTGGGGCACAAGCTGGAGTACAACAGCCACAACGTCTATATCA TGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACA ACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCC CCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCC AGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGC TGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACA AGAAGCTTAGCCATGGCTTCCCGCCGGCGGTGGCGGCGCAGGATGATGGC ACGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGATGGACCGTCACCCTGCA GCCTGTGCTTCTGCTAGGATCAATGTGTAGGCGGCCGCGACTCTAGATCATA ATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACA CCTCCCCCTGA 70 mer oligo specific to gene of interest
Number of Genes in Different Organisms Human ~ 30, 000 genes Yeast ~ 6200 genes Mouse ~ 30, 000 genes E. coli ~ 4200 genes Phage T 4 ~ 200 genes Influenza ~ 12 genes
Introduction Overview of fabrication of spotted microarrays Liquid Handling Resuspension of oligos www. qiageninstruments. com www. biorobotics. com Robotic Printing Spotted microarrays
Need to achieve two things: (i)Immobilize thousands of probes specific for individual genes (ii)Label m. RNA populations
Introduction cy 3 and cy 5: Commonly used dyes cy 5 664 nm emission cy 3 510 nm emission cy 3 www. amersham. com cy 5 Differential dye incorporation 562 nm cy 5 less well than cy 3 Light sensitivity: cy 5 more easily degraded Protect your reactions from light!!
Introduction Spotted microarray target preparation Direct labeling Target preparation Labeled c. DNA preparation EGFP Spotted Microarray EGFP KD 2 Sample RNA cy 3 Reverse transcription Flourescent dyes c. DNA cy 5 c. DNA Combined in equal amounts Co-hybridized to array www. genetics. ucla. edu
Introduction Spotted microarray target preparation Direct labeling Target preparation Labeled c. DNA preparation EGFP Spotted Microarray EGFP KD 2 Sample RNA cy 3 Reverse transcription Flourescent dyes c. DNA cy 5 c. DNA Combined in equal amounts yellow cy 3=cy 5 red cy 5>cy 3 Co-hybridized to array green cy 3>cy 5 www. genetics. ucla. edu
Target preparation Array preparation c. DNA “Two Color Chips” summary
This is the kind of thing you will see in YOUR microarray experiments
What’s happening at each spot?
c. DNA Chip vs. Northern Blot
Introduction Two Popular Microarraying Platforms Spotted microarrays www. molgen. mpg. de c. DNA: PCR products (500 -1, 000 bp) synthesized oligos (70 mer) >10, 000 probes Commercially available Oligo microarray www. the-scientist. com Affymetrix “Gene Chip” 500, 000 probes 25 mer (represents a fragment of a gene)
So. . what gene probes are represented on the array you will use? ? EGFP, p 53, EXO 1, AAG, ATM, and ATR…. But we added in a bunch more!!
ABH BTG 1 alk. B homolog DMC 1 ABH 2 CASP 2 DUT ABH 3 CASP 3 EGFP ADPRT CASP 8 ADPRTL 2 CASP 9 ERCC 1 ADPRTL 3 CCNH ERCC 2 APEX CDK 2 ERCC 3 APEXL 2 CDK 4 ERCC 4 ENDOG ATM CDK 6 ATR CDK 7 EXO 1 BID CDK 8 FANCA BLM CETN 2 BRCA 1 BRCA 2 Breast cancer 1 DCLRE 1 A DDB 1 ERCC 5 FANCC FANCE FANCF G 22 P 1 Growth. POLQ arrest and DNA-damage-inducible GADD 45 A GADD 45 B GADD 45 G GTF 2 H 4 Excision repair HAP 1 HCNP HSU 24186 HUS 1 JUN LIG 1 LIG 3 LIG 4 MAD 2 L 2 PRKDC PRSS 25 RAD 17 RAD 18 RAD 23 A RAD 23 B RAD 50 RAD 51 C RAD 51 L 1 RAD 51 L 3 RAD 52 No homology to Human sequences Alien DNA
RNA quality control Pre-labeling quality control: Determine RNA Quality Agilent Bioanalyzer: 50 -500 ng No more formaldehyde gels!! Liver Gel Image (in silico) Sharp, Clear Bands 6 kb 4 kb 28 S 2 kb 18 S 1 kb 0. 5 kb 0. 2 kb Lad, 1, 2 Electropherogram (28 S/18 S Ratio~2)
Microarray Measurements Image Analysis: Spotted arrays Scanner Image Analysis . txt or. xls file
- Slides: 30