6COVID19 Virus continued Bad News Wrapped in Protein

6_COVID-19 Virus continued Bad News Wrapped in Protein: Inside the Coronavirus Genome 1

2

Key events in the early stage of SARS-Co. V-2 outbreak. 3

SARS-Co. V-2 Proteins Why study proteins associated with viruses? Proteins associated with virions: Structural proteins: viral genome Incorporated into virion Capsid, Envelope, Spike, Membrane Fusion Nonstructural proteins: viral genome Not in the virion but made by host cells Host proteins: host genome Incorporated into virion 4

SARS-Co. V-2 Proteins Why study proteins associated with viruses? Proteins associated with virions: Structural proteins: viral genome Incorporated into virion Capsid, Envelope, Spike, Membrane Fusion Nonstructural proteins: viral genome Not in the virion but made by host cells Host proteins: host genome Incorporated into virion 5

SARS-Co. V-2 Proteins are the targets for antibodies and for drugs 6

SARS-Co. V-2 Proteins 7

SARS-Co. V-2 Proteins Cellular Saboteur · NSP 1 Blocks cells own protein production in favor of viral proteins Mystery Protein · NSP 2 It’s a mystery Untagging and Cutting · NSP 3 Frees up viral proteins from larger proteins to do their job Blocks tagging of proteins for destruction Bubble Maker · NSP 4 Creates sites (bubbles) for construction of new virions 8

SARS-Co. V-2 Proteins Bottom line!! We know an awful lot about this virus! 9

SARS-Co. V-2 Proteins Mutations 10

SARS-Co. V-2 Proteins 11

Viral mutations result in proteins that could enhance or decrease infectivity of virus Example: Ebola Enveloped virus Negative-sense RNA genome 12

auguuuuucuuguuuuauugccacuagucucuagucaguguguuaaucuuacaaccagaacucaauuacccccugcauacacuaauucuuuca cacgugguguuuauuacccugacaaaguuuucagauccucaguuuuacauucaacucaggacuuguucuuaccuuuuccaauguuacuugguu ccaugcuauacaugucucugggaccaaugguacuaagagguuugauaacccuguccuaccauuuaaugaugguguuuauuuugcuuccacugagaag ucuaacauaauaagaggcuggauuuuugguacuacuuuagauucgaagacccagucccuacuuauuguuaauaacgcuacuaauguuguuauuaaag ucugugaauuucaauuuuguaaugauccauuuuuggguguuuauuaccacaaaaacaacaaaaguuggaaagugaguucagaguuuauucua gugcgaauaauugcacuuuugaauaugucucucagccuuuucuuauggaccuugaaggaaaacaggguaauuucaaaaaucuuagggaauuugugu uuaagaauauugaugguuauuuuaaaauauauucuaagcacacgccuauuaauuuagugcgugaucucccucaggguuuuucggcuuuagaaccauu gguagauuugccaauagguauuaacaucacuagguuucaaacuuuacuugcuuuacauagaaguuauuugacuccuggugauucuucuucagguugg ACE 2 ON HOST CELL acagcuggugcugcagcuuauuauguggguuaucuucaaccuaggacuuuucuauuaaaauauaaugaaaauggaaccauuacagaugcuguagacu gugcacuugacccucucucagaaacaaaguguacguugaaauccuucacuguagaaaaaggaaucuaucaaacuucuaacuuuagaguccaac agaaucuauuguuagauuuccuaauauuacaaacuugugcccuuuuggugaaguuuuuaacgccaccagauuugcaucuguuuaugcuuggaacagg aagagaaucagcaacuguguugcugauuauucuguccuauauaauuccgcaucauuuuccacuuuuaaguguuauggagugucuccuacuaaauuaa augaucucugcuuuacuaaugucuaugcagauucauuuguaauuagaggugaugaagucagacaaaucgcuccagggcaaacuggaaagauugcuga uuauaaauuaccagaugauuuuacaggcugcguuauagcuuggaauucuaacaaucuugauucuaagguuggugguaauuaccu guauagauuguuuaggaagucuaaucucaaaccuuuugagauauuucaacugaaaucuaucaggccgguagcacaccuuguaaugguguugaa gguuuuaauuguuacuuuccuuuacaaucauaugguuuccaacccacuaaugguguugguuaccauacagaguaguaguacuuuugaac 4 PROTEINS THAT uucuacaugcaccagcaacuguuuguggaccuaaaaagucuacuaauuugguuaaaaacaaaugugucaauuucaacuucaaugguuuaacaggcac FORM SPIKE agguguucuuacugagucuaacaaaaaguuucugccuuuccaacaauuuggcagagacauugcugacacuacugaugcuguccgugauccacagaca cuugagauucuugacauuacaccauguucuuuugguggugucaguguuauaacaccaggaacaaauacuucuaaccagguugcuguucuuuaucagg auguuaacugcacagaagucccuguugcuauucaugcagaucaacuuacuccuacuuggcguguuuauucuacagguucuaauguuuuucaaacacg ugcaggcuguuuaauaggggcugaacaugucaacaacucauaugagugugacauacccauuggugcagguauaugcgcuaguuaucagacu aauucuccucggcgggcacguaguguagcuagucaauccaucauugccuacacuaugucacuuggugcagaaaauucaguugcuuacucuaauaacuc uauugccauacccacaaauuuuacuauuaguguuaccacagaaauucuaccagugucuaugaccaagacaucaguagauuguacaauguacauuugu ggugauucaacugaaugcagcaaucuuuuguugcaauauggcaguuuuuguacacaauuaaaccgugcuuuaacuggaauagcuguugaacaagaca 13 aaaacacccaagaaguuuuugcacaagucaaauuuacaaaacaccaccaauuaaagauuuuggugguuuuaauuuuucacaaauauuaccaga SARS-Co. V-2 Proteins Following proteins is crucial to this pandemic

How long does SARS-Co. V-2 last on surfaces 14

SARS-Co. V-2 RNA was identified on a variety of surfaces in cabins of both symptomatic and asymptomatic infected passengers up to 17 days after cabins were vacated on the Diamond Princess 15

During the initial isolation of 13 individuals confirmed positive with COVID-19 infection, air and surface samples were collected in eleven isolation rooms to examine viral shedding from isolated individuals. …Many commonly used items, toilet facilities, and air samples had evidence of viral contamination, indicating that SARS-Co. V-2 is shed to the environment as expired particles, during toileting, and through contact with fomites. 16

The longest observed duration of viral shedding in survivors was 37 days. 17

Virion Structure Why are envelopes important? Enveloped viruses are more “fragile” than naked viruses Respiratory Transmission Fomite transmission 18

What do these studies have in common? They all used the same test! 19

Quantitative Reverse-Transcription Polymerase Chain Reaction (q. RT-PCR or Real time PCR) • Were you infected by the virion? • Does not tell you how infectious a person is! • Does not tell you that a virion is infectious at all! • RNA viruses have high mutation rates • Some mutations can enhance virulence, other mutations decrease virulence or make virion nonfunctional • Most mutations are not beneficial • q. RT-PCR detects RNAviral but does not determine infectiousness of virion 20

q. RT-PCR is not detecting infectious virions! • Cells from people recovered from COVID-19 can still make RNAviral without making infectious virions! • Infectious virions can only be determined by examining if the virion can kill cells in culture (cells grown outside of the body) • Done by Plaque assays: a single virion can kill cells in a dish where live cells are growing causing a clear area (plaque) where the cells died. 21

q. RT-PCR is not detecting infectious virions! • Why not use plaque assays to determine infectious virions on a surface? • Time • Facilities: Biosafety containment facility (BSL-3) https: //www. forbes. com/sites/coronavirusfrontlines/2020/04/07/a-virologist-explains-why-hypedstudies-tell-us-very-little-about-the-likelihood-of-covid-19 -coronavirus-transmission/#52 bd 126 f 1 abe 22

Temperature: highly stable at 4°C, but sensitive to heat 70°C, viral inactivation was 5 mins Surfaces: virus culture was pipetted on a surface and left at room temperature (22°C) with a relative humidity of around 65% does not necessarily reflect the potential to pick up the virus from casual contact No infectious virus could be recovered from printing and tissue papers after a 3 -hour incubation, whereas no infectious virus could be detected from treated wood and cloth on day 2. By contrast, SARS-Co. V-2 was more stable on smooth surfaces. No infectious virus could be detected from treated smooth surfaces on day 4 (glass and banknote) or day 7 (stainless steel and plastic). Strikingly, a detectable level of infectious virus could still be present on the outer layer of a surgical mask on day 7 https: //www. sciencedirect. com/science/article/pii/S 2666524720300033? via%3 Dihub 23

These studies are NOT determining infectious potential of virus! 24